Mouse CLOCK(Circadian Locomoter Output Cycles Protein Kaput) ELISA Kit

Mouse CLOCK(Circadian Locomoter Output Cycles Protein Kaput) ELISA Kit

Circadian Locomoter Output Cycles Protein Kaput (Clock) Antibody

20-abx013288
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Circadian Locomoter Output Cycles Protein Kaput (CLOCK) Antibody

20-abx321582
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Circadian Locomoter Output Cycles Protein Kaput (CLOCK) Antibody

20-abx328613
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Circadian Locomoter Output Cycles Protein Kaput (CLOCK) Antibody

abx431169-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Circadian Locomoter Output Cycles Protein Kaput (CLOCK) Antibody

20-abx302600
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Circadian Locomoter Output Cycles Protein Kaput (CLOCK) Antibody

abx231769-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Circadian Locomoter Output Cycles Protein Kaput (CLOCK) Antibody

20-abx171753
  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Mouse Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit

E03C1807-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit

E03C1807-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit

E03C1807-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Circadian Locomoter Output Cycles Protein Kaput (CLOCK) ELISA Kit

20-abx258674
  • EUR 7504.00
  • EUR 3996.00
  • EUR 926.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Circadian Locomoter Output Cycles Protein Kaput (CLOCK) ELISA Kit

SEQ116Mu-10x96wellstestplate 10x96-wells test plate
EUR 5333.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Circadian Locomoter Output Cycles Protein Kaput (CLOCK) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Circadian Locomoter Output Cycles Protein Kaput (CLOCK) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Circadian Locomoter Output Cycles Protein Kaput (CLOCK) ELISA Kit

SEQ116Mu-1x48wellstestplate 1x48-wells test plate
EUR 526.89
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Circadian Locomoter Output Cycles Protein Kaput (CLOCK) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Circadian Locomoter Output Cycles Protein Kaput (CLOCK) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Circadian Locomoter Output Cycles Protein Kaput (CLOCK) ELISA Kit

SEQ116Mu-1x96wellstestplate 1x96-wells test plate
EUR 709.84
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Circadian Locomoter Output Cycles Protein Kaput (CLOCK) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Circadian Locomoter Output Cycles Protein Kaput (CLOCK) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Circadian Locomoter Output Cycles Protein Kaput (CLOCK) ELISA Kit

SEQ116Mu-5x96wellstestplate 5x96-wells test plate
EUR 2894.28
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Circadian Locomoter Output Cycles Protein Kaput (CLOCK) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Circadian Locomoter Output Cycles Protein Kaput (CLOCK) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Circadian Locomoter Output Cycles Protein Kaput (CLOCK) ELISA Kit

4-SEQ116Mu
  • EUR 5384.00
  • EUR 2845.00
  • EUR 710.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Circadian Locomoter Output Cycles Protein Kaput elisa. Alternative names of the recognized antigen: KAT13D
  • bHLHe8
  • Class E basic helix-loop-helix protein 8
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Circadian Locomoter Output Cycles Protein Kaput (CLOCK) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Circadian Locomoter Output Cycles Protein Kaput (CLOCK) CLIA Kit

20-abx496160
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Circadian Locomoter Output Cycles Protein Kaput (CLOCK) Antibody (HRP)

20-abx316830
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Circadian Locomoter Output Cycles Protein Kaput (CLOCK) Antibody (FITC)

20-abx316831
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Circadian Locomoter Output Cycles Protein Kaput (CLOCK) Antibody (Biotin)

20-abx316832
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Goat Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit

E06C1807-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit

E06C1807-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit

E06C1807-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit

E02C1807-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit

E02C1807-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit

E02C1807-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit

E04C1807-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit

E04C1807-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit

E04C1807-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit

E01C1807-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit

E01C1807-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit

E01C1807-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit

E07C1807-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit

E07C1807-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit

E07C1807-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit

E08C1807-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit

E08C1807-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit

E08C1807-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit

E09C1807-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit

E09C1807-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit

E09C1807-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Circadian Locomoter Output Cycles Protein Kaput ELISA Kit (CLOCK)

RK01134 96 Tests
EUR 521

Human Circadian Locomoter Output Cycles Protein Kaput (CLOCK) ELISA Kit

SEQ116Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Circadian Locomoter Output Cycles Protein Kaput (CLOCK) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Circadian Locomoter Output Cycles Protein Kaput (CLOCK) in tissue homogenates, cell lysates and other biological fluids.

Human Circadian Locomoter Output Cycles Protein Kaput (CLOCK) ELISA Kit

SEQ116Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Circadian Locomoter Output Cycles Protein Kaput (CLOCK) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Circadian Locomoter Output Cycles Protein Kaput (CLOCK) in tissue homogenates, cell lysates and other biological fluids.

Human Circadian Locomoter Output Cycles Protein Kaput (CLOCK) ELISA Kit

SEQ116Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Circadian Locomoter Output Cycles Protein Kaput (CLOCK) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Circadian Locomoter Output Cycles Protein Kaput (CLOCK) in tissue homogenates, cell lysates and other biological fluids.

Human Circadian Locomoter Output Cycles Protein Kaput (CLOCK) ELISA Kit

SEQ116Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Circadian Locomoter Output Cycles Protein Kaput (CLOCK) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Circadian Locomoter Output Cycles Protein Kaput (CLOCK) in tissue homogenates, cell lysates and other biological fluids.

Human Circadian Locomoter Output Cycles Protein Kaput (CLOCK) ELISA Kit

4-SEQ116Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Circadian Locomoter Output Cycles Protein Kaput elisa. Alternative names of the recognized antigen: KAT13D
  • bHLHe8
  • Class E basic helix-loop-helix protein 8
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Circadian Locomoter Output Cycles Protein Kaput (CLOCK) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Mouse CLOCK (Circadian Locomoter Output Cycles Protein Kaput)

ELK8166 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Circadian Locomoter Output Cycles Protein Kaput (CLOCK). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated
  • Show more
Description: A sandwich ELISA kit for detection of Circadian Locomoter Output Cycles Protein Kaput from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Guinea pig Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit

E05C1807-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit

E05C1807-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit

E05C1807-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human CLOCK (Circadian Locomoter Output Cycles Protein Kaput)

ELK6572 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Circadian Locomoter Output Cycles Protein Kaput (CLOCK). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated
  • Show more
Description: A sandwich ELISA kit for detection of Circadian Locomoter Output Cycles Protein Kaput from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Clock Homolog (CLOCK) ELISA Kit

DLR-CLOCK-Hu-48T 48T
EUR 554
  • Should the Human Clock Homolog (CLOCK) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Clock Homolog (CLOCK) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Clock Homolog (CLOCK) ELISA Kit

DLR-CLOCK-Hu-96T 96T
EUR 725
  • Should the Human Clock Homolog (CLOCK) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Clock Homolog (CLOCK) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Clock Homolog (CLOCK) ELISA Kit

RDR-CLOCK-Hu-48Tests 48 Tests
EUR 589

Human Clock Homolog (CLOCK) ELISA Kit

RDR-CLOCK-Hu-96Tests 96 Tests
EUR 820

Human Clock Homolog (CLOCK) ELISA Kit

RD-CLOCK-Hu-48Tests 48 Tests
EUR 563

Human Clock Homolog (CLOCK) ELISA Kit

RD-CLOCK-Hu-96Tests 96 Tests
EUR 783

Circadian Clock Protein PASD1 (PASD1) Antibody

abx030966-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Circadian Clock Protein PASD1 (PASD1) Antibody

abx030966-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Circadian Clock Protein PASD1 (PASD1) Antibody

abx340216-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Circadian Clock Protein PASD1 (PASD1) Antibody

20-abx302666
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Clock/ Rat Clock ELISA Kit

ELI-50992r 96 Tests
EUR 886

Mouse Clock ELISA KIT

ELI-33824m 96 Tests
EUR 865

Human Clock Homolog (CLOCK) ELISA Kit

20-abx151098
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Clock Homolog (CLOCK)ELISA Kit

201-12-2901 96 tests
EUR 440
  • This Clock Homolog ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Clock Homolog(CLOCK)ELISA Kit

QY-E05041 96T
EUR 361

Clock ELISA Kit (Mouse) (OKCD02092)

OKCD02092 96 Wells
EUR 936
Description: Description of target: Transcriptional activator which forms a core component of the circadian clock. The circadian clock, an internal time-keeping system, regulates various physiological processes through the generation of approximately 24 hour circadian rhythms in gene expression, which are translated into rhythms in metabolism and behavior. It is derived from the Latin roots 'circa' (about) and 'diem' (day) and acts as an important regulator of a wide array of physiological functions including metabolism, sleep, body temperature, blood pressure, endocrine, immune, cardiovascular, and renal function. Consists of two major components: the central clock, residing in the suprachiasmatic nucleus (SCN) of the brain, and the peripheral clocks that are present in nearly every tissue and organ system. Both the central and peripheral clocks can be reset by environmental cues, also known as Zeitgebers (German for 'timegivers'). The predominant Zeitgeber for the central clock is light, which is sensed by retina and signals directly to the SCN. The central clock entrains the peripheral clocks through neuronal and hormonal signals, body temperature and feeding-related cues, aligning all clocks with the external light/dark cycle. Circadian rhythms allow an organism to achieve temporal homeostasis with its environment at the molecular level by regulating gene expression to create a peak of protein expression once every 24 hours to control when a particular physiological process is most active with respect to the solar day. Transcription and translation of core clock components (CLOCK, NPAS2, ARNTL/BMAL1, ARNTL2/BMAL2, PER1, PER2, PER3, CRY1 and CRY2) plays a critical role in rhythm generation, whereas delays imposed by post-translational modifications (PTMs) are important for determining the period (tau) of the rhythms (tau refers to the period of a rhythm and is the length, in time, of one complete cycle). A diurnal rhythm is synchronized with the day/night cycle, while the ultradian and infradian rhythms have a period shorter and longer than 24 hours, respectively. Disruptions in the circadian rhythms contribute to the pathology of cardiovascular diseases, cancer, metabolic syndromes and aging. A transcription/translation feedback loop (TTFL) forms the core of the molecular circadian clock mechanism. Transcription factors, CLOCK or NPAS2 and ARNTL/BMAL1 or ARNTL2/BMAL2, form the positive limb of the feedback loop, act in the form of a heterodimer and activate the transcription of core clock genes and clock-controlled genes (involved in key metabolic processes), harboring E-box elements (5'-CACGTG-3') within their promoters. The core clock genes: PER1/2/3 and CRY1/2 which are transcriptional repressors form the negative limb of the feedback loop and interact with the CLOCK|NPAS2-ARNTL/BMAL1|ARNTL2/BMAL2 heterodimer inhibiting its activity and thereby negatively regulating their own expression. This heterodimer also activates nuclear receptors NR1D1/2 and RORA/B/G, which form a second feedback loop and which activate and repress ARNTL/BMAL1 transcription, respectively. CLOCK has an intrinsic acetyltransferase activity, which enables circadian chromatin remodeling by acetylating histones and nonhistone proteins, including its own partner ARNTL/BMAL1. Regulates the circadian expression of ICAM1, VCAM1, CCL2, THPO and MPL and also acts as an enhancer of the transactivation potential of NF-kappaB. Plays an important role in the homeostatic regulation of sleep. The CLOCK-ARNTL/BMAL1 heterodimer regulates the circadian expression of SERPINE1/PAI1, VWF, B3, CCRN4L/NOC, NAMPT, DBP, MYOD1, PPARGC1A, PPARGC1B, SIRT1, GYS2, F7, NGFR, GNRHR, BHLHE40/DEC1, ATF4, MTA1, KLF10 and also genes implicated in glucose and lipid metabolism. Represses glucocorticoid receptor NR3C1/GR-induced transcriptional activity by reducing the association of NR3C1/GR to glucocorticoid response elements (GREs) via the acetylation of multiple lysine residues located in its hinge region. Promotes rhythmic chromatin opening, regulating the DNA accessibility of other transcription factors. May play a role in spermatogenesis; contributes to the chromatoid body assembly and physiology. The CLOCK-ARNTL2/BMAL2 heterodimer activates the transcription of SERPINE1/PAI1 and BHLHE40/DEC1.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.063 ng/mL

Human Clock Homolog (CLOCK) Protein

20-abx650822
  • EUR 634.00
  • EUR 272.00
  • EUR 1929.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Clock Cell ELISA Kit

abx595660-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Chicken CLOCK ELISA KIT

ELI-09126c 96 Tests
EUR 928

CLOCK ELISA KIT|Human

EF008732 96 Tests
EUR 689

Human CLOCK ELISA KIT

ELI-50183h 96 Tests
EUR 824

Human Clock Homolog (CLOCK) CLIA Kit

20-abx496159
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Period Circadian Protein 1(PER1)ELISA kit

GA-E0899MS-48T 48T
EUR 336

Mouse Period Circadian Protein 1(PER1)ELISA kit

GA-E0899MS-96T 96T
EUR 534

Mouse Period Circadian Protein 1(PER1)ELISA kit

QY-E21151 96T
EUR 361

Clock Homolog (CLOCK) Antibody

20-abx131224
  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Recombinant Clock Homolog (CLOCK)

4-RPQ116Hu01
  • EUR 454.82
  • EUR 224.00
  • EUR 1430.56
  • EUR 543.52
  • EUR 987.04
  • EUR 367.00
  • EUR 3426.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O15516
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 44.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Circadian Locomoter Output Cycles Protein Kaput expressed in: E.coli

Mouse Period circadian protein homolog 2, Per2 ELISA KIT

ELI-14631m 96 Tests
EUR 865

Mouse Period circadian protein homolog 3, Per3 ELISA KIT

ELI-14632m 96 Tests
EUR 865

Mouse Period circadian protein homolog 1, Per1 ELISA KIT

ELI-44921m 96 Tests
EUR 865

Mouse Period Circadian Protein Homolog 3 (PER3) ELISA Kit

abx390189-96tests 96 tests
EUR 911
  • Shipped within 20 working days.

CLOCK ELISA Kit (Human) (OKCD01088)

OKCD01088 96 Wells
EUR 909
Description: Description of target: Transcriptional activator which forms a core component of the circadian clock. The circadian clock, an internal time-keeping system, regulates various physiological processes through the generation of approximately 24 hour circadian rhythms in gene expression, which are translated into rhythms in metabolism and behavior. It is derived from the Latin roots 'circa' (about) and 'diem' (day) and acts as an important regulator of a wide array of physiological functions including metabolism, sleep, body temperature, blood pressure, endocrine, immune, cardiovascular, and renal function. Consists of two major components: the central clock, residing in the suprachiasmatic nucleus (SCN) of the brain, and the peripheral clocks that are present in nearly every tissue and organ system. Both the central and peripheral clocks can be reset by environmental cues, also known as Zeitgebers (German for 'timegivers'). The predominant Zeitgeber for the central clock is light, which is sensed by retina and signals directly to the SCN. The central clock entrains the peripheral clocks through neuronal and hormonal signals, body temperature and feeding-related cues, aligning all clocks with the external light/dark cycle. Circadian rhythms allow an organism to achieve temporal homeostasis with its environment at the molecular level by regulating gene expression to create a peak of protein expression once every 24 hours to control when a particular physiological process is most active with respect to the solar day. Transcription and translation of core clock components (CLOCK, NPAS2, ARNTL/BMAL1, ARNTL2/BMAL2, PER1, PER2, PER3, CRY1 and CRY2) plays a critical role in rhythm generation, whereas delays imposed by post-translational modifications (PTMs) are important for determining the period (tau) of the rhythms (tau refers to the period of a rhythm and is the length, in time, of one complete cycle). A diurnal rhythm is synchronized with the day/night cycle, while the ultradian and infradian rhythms have a period shorter and longer than 24 hours, respectively. Disruptions in the circadian rhythms contribute to the pathology of cardiovascular diseases, cancer, metabolic syndromes and aging. A transcription/translation feedback loop (TTFL) forms the core of the molecular circadian clock mechanism. Transcription factors, CLOCK or NPAS2 and ARNTL/BMAL1 or ARNTL2/BMAL2, form the positive limb of the feedback loop, act in the form of a heterodimer and activate the transcription of core clock genes and clock-controlled genes (involved in key metabolic processes), harboring E-box elements (5'-CACGTG-3') within their promoters. The core clock genes: PER1/2/3 and CRY1/2 which are transcriptional repressors form the negative limb of the feedback loop and interact with the CLOCK|NPAS2-ARNTL/BMAL1|ARNTL2/BMAL2 heterodimer inhibiting its activity and thereby negatively regulating their own expression. This heterodimer also activates nuclear receptors NR1D1/2 and RORA/B/G, which form a second feedback loop and which activate and repress ARNTL/BMAL1 transcription, respectively. CLOCK has an intrinsic acetyltransferase activity, which enables circadian chromatin remodeling by acetylating histones and nonhistone proteins, including its own partner ARNTL/BMAL1. Regulates the circadian expression of ICAM1, VCAM1, CCL2, THPO and MPL and also acts as an enhancer of the transactivation potential of NF-kappaB. Plays an important role in the homeostatic regulation of sleep. The CLOCK-ARNTL/BMAL1 heterodimer regulates the circadian expression of SERPINE1/PAI1, VWF, B3, CCRN4L/NOC, NAMPT, DBP, MYOD1, PPARGC1A, PPARGC1B, SIRT1, GYS2, F7, NGFR, GNRHR, BHLHE40/DEC1, ATF4, MTA1, KLF10 and also genes implicated in glucose and lipid metabolism. Represses glucocorticoid receptor NR3C1/GR-induced transcriptional activity by reducing the association of NR3C1/GR to glucocorticoid response elements (GREs) via the acetylation of multiple lysine residues located in its hinge region. Promotes rhythmic chromatin opening, regulating the DNA accessibility of other transcription factors. The CLOCK-ARNTL2/BMAL2 heterodimer activates the transcription of SERPINE1/PAI1 and BHLHE40/DEC1.7 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.8"Histone acetyltransferase-dependent chromatin remodeling and the vascular clock."_x005F_x005F_x000D_Curtis A.M., Seo S.B., Westgate E.J., Rudic R.D., Smyth E.M., Chakravarti D., FitzGerald G.A., McNamara P._x005F_x005F_x000D_J. Biol. Chem. 279:7091-7097(2004) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, INTERACTION WITH KAT2B; CREBBP AND EP300.Ref.10"CLOCK/BMAL1 regulates human nocturnin transcription through binding to the E-box of nocturnin promoter."_x005F_x005F_x000D_Li R., Yue J., Zhang Y., Zhou L., Hao W., Yuan J., Qiang B., Ding J.M., Peng X., Cao J.M._x005F_x005F_x000D_Mol. Cell. Biochem. 317:169-177(2008) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.13"Peripheral CLOCK regulates target-tissue glucocorticoid receptor transcriptional activity in a circadian fashion in man."_x005F_x005F_x000D_Charmandari E., Chrousos G.P., Lambrou G.I., Pavlaki A., Koide H., Ng S.S., Kino T._x005F_x005F_x000D_PLoS ONE 6:E25612-E25612(2011) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, INTERACTION WITH NR3C1.Ref.14"A DNA damage response screen identifies RHINO, a 9-1-1 and TopBP1 interacting protein required for ATR signaling."_x005F_x005F_x000D_Cotta-Ramusino C., McDonald E.R. III, Hurov K., Sowa M.E., Harper J.W., Elledge S.J._x005F_x005F_x000D_Science 332:1313-1317(2011) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION.Ref.16"Diurnal expression of the thrombopoietin gene is regulated by CLOCK."_x005F_x005F_x000D_Tracey C.J., Pan X., Catterson J.H., Harmar A.J., Hussain M.M., Hartley P.S._x005F_x005F_x000D_J. Thromb. Haemost. 10:662-669(2012) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.19"p75 neurotrophin receptor is a clock gene that regulates oscillatory components of circadian and metabolic networks."_x005F_x005F_x000D_Baeza-Raja B., Eckel-Mahan K., Zhang L., Vagena E., Tsigelny I.F., Sassone-Corsi P., Ptacek L.J., Akassoglou K._x005F_x005F_x000D_J. Neurosci. 33:10221-10234(2013) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.22"A meeting of two chronobiological systems: circadian proteins Period1 and BMAL1 modulate the human hair cycle clock."_x005F_x005F_x000D_Al-Nuaimi Y., Hardman J.A., Biro T., Haslam I.S., Philpott M.P., Toth B.I., Farjo N., Farjo B., Baier G., Watson R.E., Grimaldi B., Kloepper J.E., Paus R._x005F_x005F_x000D_J. Invest. Dermatol. 134:610-619(2014) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, TISSUE SPECIFICITY. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.117 ng/mL

CLOCK ELISA Kit (Human) (OKAN04742)

OKAN04742 96 Wells
EUR 792
Description: Description of target: The protein encoded by this gene plays a central role in the regulation of circadian rhythms. The protein encodes a transcription factor of the basic helix-loop-helix (bHLH) family and contains DNA binding histone acetyltransferase activity. The encoded protein forms a heterodimer with ARNTL (BMAL1) that binds E-box enhancer elements upstream of Period (PER1, PER2, PER3) and Cryptochrome (CRY1, CRY2) genes and activates transcription of these genes. PER and CRY proteins heterodimerize and repress their own transcription by interacting in a feedback loop with CLOCK/ARNTL complexes. Polymorphisms in this gene may be associated with behavioral changes in certain populations and with obesity and metabolic syndrome. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.117 ng/mL

CLOCK ELISA Kit (Human) (OKEH08376)

OKEH08376 96 Wells
EUR 896
Description: Description of target: The protein encoded by this gene plays a central role in the regulation of circadian rhythms. The protein encodes a transcription factor of the basic helix-loop-helix (bHLH) family and contains DNA binding histone acetyltransferase activity. The encoded protein forms a heterodimer with ARNTL (BMAL1) that binds E-box enhancer elements upstream of Period (PER1, PER2, PER3) and Cryptochrome (CRY1, CRY2) genes and activates transcription of these genes. PER and CRY proteins heterodimerize and repress their own transcription by interacting in a feedback loop with CLOCK/ARNTL complexes. Polymorphisms in this gene may be associated with behavioral changes in certain populations and with obesity and metabolic syndrome. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.089ng/mL

Per3 ELISA Kit| Mouse Period circadian protein homolog 3 ELISA

EF015828 96 Tests
EUR 689

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Mouse CLOCK shRNA Plasmid

20-abx969707
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Clock Homolog (CLOCK) Polyclonal Antibody (Human)

4-PAQ116Hu01
  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLOCK (Ala34~Ala379)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Clock Homolog (CLOCK)

Human Period Circadian Protein 1 (PER1) ELISA Kit

20-abx585343
  • EUR 7645.00
  • EUR 4074.00
  • EUR 942.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Period Circadian Protein 2 (PER2) ELISA Kit

20-abx155964
  • EUR 7911.00
  • EUR 4215.00
  • EUR 973.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Period Circadian Protein 1 (PER1) ELISA Kit

20-abx152702
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Period Circadian Protein 1 (PER1)ELISA kit

201-12-3257 96 tests
EUR 440
  • This Period Circadian Protein 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Period Circadian Protein 1 (PER1) ELISA Kit

DLR-PER1-Hu-48T 48T
EUR 554
  • Should the Human Period Circadian Protein 1 (PER1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Period Circadian Protein 1 (PER1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Period Circadian Protein 1 (PER1) ELISA Kit

DLR-PER1-Hu-96T 96T
EUR 725
  • Should the Human Period Circadian Protein 1 (PER1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Period Circadian Protein 1 (PER1) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Period Circadian Protein 2 (PER2) ELISA Kit

DLR-PER2-Ra-48T 48T
EUR 590
  • Should the Rat Period Circadian Protein 2 (PER2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Period Circadian Protein 2 (PER2) in samples from tissue homogenates or other biological fluids.

Rat Period Circadian Protein 2 (PER2) ELISA Kit

DLR-PER2-Ra-96T 96T
EUR 774
  • Should the Rat Period Circadian Protein 2 (PER2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Period Circadian Protein 2 (PER2) in samples from tissue homogenates or other biological fluids.

Human Period Circadian Protein 1 ELISA Kit (PER1)

RK02058 96 Tests
EUR 521

Human Period Circadian Protein 1 (PER1) ELISA Kit

RD-PER1-Hu-48Tests 48 Tests
EUR 563

Human Period Circadian Protein 1 (PER1) ELISA Kit

RD-PER1-Hu-96Tests 96 Tests
EUR 783

Rat Period Circadian Protein 2 (PER2) ELISA Kit

RD-PER2-Ra-48Tests 48 Tests
EUR 603

Rat Period Circadian Protein 2 (PER2) ELISA Kit

RD-PER2-Ra-96Tests 96 Tests
EUR 840

Human Period Circadian Protein 1 (PER1) ELISA Kit

RDR-PER1-Hu-48Tests 48 Tests
EUR 589

Human Period Circadian Protein 1 (PER1) ELISA Kit

RDR-PER1-Hu-96Tests 96 Tests
EUR 820

Rat Period Circadian Protein 2 (PER2) ELISA Kit

RDR-PER2-Ra-48Tests 48 Tests
EUR 631

Rat Period Circadian Protein 2 (PER2) ELISA Kit

RDR-PER2-Ra-96Tests 96 Tests
EUR 880

Human Period Circadian Protein 1(PER1)ELISA Kit

QY-E02797 96T
EUR 361

Rat Period Circadian Protein 1(PER1)ELISA kit

QY-E10554 96T
EUR 361

Human Period Circadian Protein 1 (PER1) ELISA Kit

SEM012Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Period Circadian Protein 1 (PER1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Period Circadian Protein 1 (PER1) in Tissue homogenates, cell lysates and other biological fluids.

Human Period Circadian Protein 1 (PER1) ELISA Kit

SEM012Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Period Circadian Protein 1 (PER1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Period Circadian Protein 1 (PER1) in Tissue homogenates, cell lysates and other biological fluids.

Human Period Circadian Protein 1 (PER1) ELISA Kit

SEM012Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Period Circadian Protein 1 (PER1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Period Circadian Protein 1 (PER1) in Tissue homogenates, cell lysates and other biological fluids.

Human Period Circadian Protein 1 (PER1) ELISA Kit

SEM012Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Period Circadian Protein 1 (PER1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Period Circadian Protein 1 (PER1) in Tissue homogenates, cell lysates and other biological fluids.

Human Period Circadian Protein 1 (PER1) ELISA Kit

4-SEM012Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Period Circadian Protein 1 elisa. Alternative names of the recognized antigen: PER
  • RIGUI
  • hPER
  • Circadian clock protein PERIOD 1
  • Circadian pacemaker protein Rigui
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Period Circadian Protein 1 (PER1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Period Circadian Protein 2 (PER2) ELISA Kit

SEM013Ra-10x96wellstestplate 10x96-wells test plate
EUR 5621.62
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Period Circadian Protein 2 (PER2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Period Circadian Protein 2 (PER2) in Tissue homogenates and other biological fluids.

Rat Period Circadian Protein 2 (PER2) ELISA Kit

SEM013Ra-1x48wellstestplate 1x48-wells test plate
EUR 550.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Period Circadian Protein 2 (PER2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Period Circadian Protein 2 (PER2) in Tissue homogenates and other biological fluids.

Rat Period Circadian Protein 2 (PER2) ELISA Kit

SEM013Ra-1x96wellstestplate 1x96-wells test plate
EUR 743.72
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Period Circadian Protein 2 (PER2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Period Circadian Protein 2 (PER2) in Tissue homogenates and other biological fluids.

Rat Period Circadian Protein 2 (PER2) ELISA Kit

SEM013Ra-5x96wellstestplate 5x96-wells test plate
EUR 3046.74
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Period Circadian Protein 2 (PER2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Period Circadian Protein 2 (PER2) in Tissue homogenates and other biological fluids.

Rat Period Circadian Protein 2 (PER2) ELISA Kit

4-SEM013Ra
  • EUR 5672.00
  • EUR 2997.00
  • EUR 744.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Period Circadian Protein 2 elisa. Alternative names of the recognized antigen: FASPS
  • Circadian clock protein PERIOD 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Period Circadian Protein 2 (PER2) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

CLOCK siRNA

20-abx901118
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CLOCK Antibody

BF0128 200ul
EUR 376
Description: CLOCK antibody detects endogenous levels of total CLOCK.

Clock Antibody

AF0323 200ul
EUR 304
Description: Clock antibody detects endogenous levels of total Clock.

Clock Antibody

ABF0323 100 ug
EUR 438

CLOCK siRNA

20-abx912113
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CLOCK siRNA

20-abx912114
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Clock antibody

70R-33701 100 ug
EUR 327
Description: Rabbit polyclonal Clock antibody

Clock Antibody

ABD3019 100 ug
EUR 438

CLOCK antibody

38677-100ul 100ul
EUR 252

CLOCK Antibody

3896-100
EUR 316

CLOCK Antibody

3896-30T
EUR 146

CLOCK ) Antibody

39300-100ul 100ul
EUR 390

Clock Antibody

33580-100ul 100ul
EUR 252

Clock Antibody

33580-50ul 50ul
EUR 187

CLOCK Antibody

49586-100ul 100ul
EUR 333

CLOCK Antibody

49586-50ul 50ul
EUR 239

CLOCK antibody

10R-1414 100 ug
EUR 512
Description: Mouse monoclonal CLOCK antibody

CLOCK antibody

10R-1897 100 ul
EUR 381
Description: Mouse monoclonal CLOCK antibody

CLOCK antibody

70R-12173 100 ug
EUR 403
Description: Rabbit polyclonal CLOCK antibody

Clock Antibody

DF3019 200ul
EUR 304
Description: Clock Antibody detects endogenous levels of total Clock.

CLOCK Antibody

1-CSB-PA001722
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CLOCK. Recognizes CLOCK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

CLOCK Antibody

1-CSB-PA005574EA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CLOCK. Recognizes CLOCK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

CLOCK Antibody

1-CSB-PA005574ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CLOCK. Recognizes CLOCK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

Clock Homolog (CLOCK) Polyclonal Antibody (Human), APC

4-PAQ116Hu01-APC
  • EUR 368.00
  • EUR 3599.00
  • EUR 993.00
  • EUR 472.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLOCK (Ala34~Ala379)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Clock Homolog (CLOCK). This antibody is labeled with APC.

Clock Homolog (CLOCK) Polyclonal Antibody (Human), Biotinylated

4-PAQ116Hu01-Biotin
  • EUR 328.00
  • EUR 2697.00
  • EUR 786.00
  • EUR 404.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLOCK (Ala34~Ala379)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Clock Homolog (CLOCK). This antibody is labeled with Biotin.

Clock Homolog (CLOCK) Polyclonal Antibody (Human), Cy3

4-PAQ116Hu01-Cy3
  • EUR 449.00
  • EUR 4757.00
  • EUR 1283.00
  • EUR 588.00
  • EUR 264.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLOCK (Ala34~Ala379)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Clock Homolog (CLOCK). This antibody is labeled with Cy3.

Clock Homolog (CLOCK) Polyclonal Antibody (Human), FITC

4-PAQ116Hu01-FITC
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLOCK (Ala34~Ala379)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Clock Homolog (CLOCK). This antibody is labeled with FITC.

Clock Homolog (CLOCK) Polyclonal Antibody (Human), HRP

4-PAQ116Hu01-HRP
  • EUR 335.00
  • EUR 3135.00
  • EUR 877.00
  • EUR 426.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLOCK (Ala34~Ala379)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Clock Homolog (CLOCK). This antibody is labeled with HRP.

Clock Homolog (CLOCK) Polyclonal Antibody (Human), PE

4-PAQ116Hu01-PE
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLOCK (Ala34~Ala379)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Clock Homolog (CLOCK). This antibody is labeled with PE.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Clock ORF Vector (Mouse) (pORF)

ORF041591 1.0 ug DNA
EUR 506

Human PER1( Period circadian protein homolog 1) ELISA Kit

EH11018 96T
EUR 567.6
  • Detection range: 15.625-1000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Human PER2(Period circadian protein homolog 2) ELISA Kit

EH11019 96T
EUR 567.6
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: O15055
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Period circadian protein homolog 2, PER2 ELISA KIT

ELI-20905h 96 Tests
EUR 824

Chicken Period circadian protein homolog 2, PER2 ELISA KIT

ELI-15153c 96 Tests
EUR 928

Human Period circadian protein homolog 1, PER1 ELISA KIT

ELI-16042h 96 Tests
EUR 824

ELISA kit for Human PER1 (Period Circadian Protein 1)

ELK6571 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Period Circadian Protein 1 (PER1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of Period Circadian Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat Period circadian protein homolog 1, Per1 ELISA KIT

ELI-37426r 96 Tests
EUR 886

Human Period circadian protein homolog 3, PER3 ELISA KIT

ELI-43670h 96 Tests
EUR 824

ELISA kit for Rat PER2 (Period Circadian Protein 2)

ELK8024 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Period Circadian Protein 2 (PER2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of Period Circadian Protein 2 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Period circadian protein homolog 2 (PER32) ELISA Kit

abx382155-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Period Circadian Protein Homolog 3 (PER3) ELISA Kit

abx382156-96tests 96 tests
EUR 911
  • Shipped within 20 working days.

Rat Period Circadian Protein Homolog 3 (PER3) ELISA Kit

abx391787-96tests 96 tests
EUR 911
  • Shipped within 20 working days.

CLOCK Protein Vector (Mouse) (pPB-C-His)

PV166362 500 ng
EUR 1065

CLOCK Protein Vector (Mouse) (pPB-N-His)

PV166363 500 ng
EUR 1065

CLOCK Protein Vector (Mouse) (pPM-C-HA)

PV166364 500 ng
EUR 1065

CLOCK Protein Vector (Mouse) (pPM-C-His)

PV166365 500 ng
EUR 1065

Clock Colorimetric Cell-Based ELISA Kit (OKAG01149)

OKAG01149 96 Wells
EUR 596
Description: Description of target: ;Species reactivity: Human, Mouse, Rat;Application: ELISA;Assay info: Assay Type: Cell-Based
Subtype: None
Detection Method: Colorimetric 450 nm;Sensitivity:

Clock Colorimetric Cell-Based ELISA

EKC1630 100ul
EUR 572

Clock Homolog (CLOCK) Polyclonal Antibody (Human), APC-Cy7

4-PAQ116Hu01-APC-Cy7
  • EUR 616.00
  • EUR 7078.00
  • EUR 1867.00
  • EUR 824.00
  • EUR 338.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLOCK (Ala34~Ala379)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Clock Homolog (CLOCK). This antibody is labeled with APC-Cy7.

Polyclonal CLOCK Antibody

AMM05779G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CLOCK . This antibody is tested and proven to work in the following applications:

CLOCK Conjugated Antibody

C49586 100ul
EUR 397

CLOCK Blocking Peptide

BF0128-BP 1mg
EUR 195

Clock Conjugated Antibody

C33580 100ul
EUR 397

Clock Blocking Peptide

AF0323-BP 1mg
EUR 195

CLOCK cloning plasmid

CSB-CL005574HU-10ug 10ug
EUR 821
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2541
  • Sequence: atgttgtttaccgtaagctgtagtaaaatgagctcgattgttgacagagatgacagtagtatttttgatgggttggtggaagaagatgacaaggacaaagcgaaaagagtatctagaaacaaatctgaaaagaaacgtagagatcaatttaatgttctcattaaagaactgggat
  • Show more
Description: A cloning plasmid for the CLOCK gene.

anti- CLOCK antibody

FNab01769 100µg
EUR 505.25
  • Immunogen: clock homolog(Mouse)
  • Uniprot ID: O15516
  • Gene ID: 9575
  • Research Area: Epigenetics, Signal Transduction, Metabolism, Cardiovascular, Neuroscience
Description: Antibody raised against CLOCK

Clock Polyclonal Antibody

ES2004-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Clock from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Clock Polyclonal Antibody

ES2004-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Clock from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

CLOCK Blocking Peptide

20-abx161360
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Clock Polyclonal Antibody

ABP51005-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Clock at AA range: 210-290
  • Applications tips:
Description: A polyclonal antibody for detection of Clock from Human, Mouse, Rat. This Clock antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Clock at AA range: 210-290

Clock Polyclonal Antibody

ABP51005-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Clock at AA range: 210-290
  • Applications tips:
Description: A polyclonal antibody for detection of Clock from Human, Mouse, Rat. This Clock antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Clock at AA range: 210-290

Clock Polyclonal Antibody

ABP51005-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Clock at AA range: 210-290
  • Applications tips:
Description: A polyclonal antibody for detection of Clock from Human, Mouse, Rat. This Clock antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Clock at AA range: 210-290

CLOCK Rabbit pAb

A5633-100ul 100 ul
EUR 308

CLOCK Rabbit pAb

A5633-200ul 200 ul
EUR 459

CLOCK Rabbit pAb

A5633-20ul 20 ul
EUR 183

CLOCK Rabbit pAb

A5633-50ul 50 ul
EUR 223

CLOCK Blocking Peptide

33R-10985 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CLOCK antibody, catalog no. 70R-12173

CLOCK Blocking Peptide

3896BP-50
EUR 153

Clock Blocking Peptide

DF3019-BP 1mg
EUR 195

Anti-CLOCK antibody

PAab01769 100 ug
EUR 355

anti-CLOCK (8F7)

LF-MA30382 100 ul
EUR 445
Description: Mouse Monoclonal to CLOCK

Anti-Clock antibody

STJ92343 200 µl
EUR 197
Description: Rabbit polyclonal to Clock.

Anti-Clock antibody

STJ97961 100 µl
EUR 234
Description: Mouse monoclonal to Clock.

Anti-CLOCK antibody

STJ11100916 100 µl
EUR 277
Description: The protein encoded by this gene plays a central role in the regulation of circadian rhythms. The protein encodes a transcription factor of the basic helix-loop-helix (bHLH) family and contains DNA binding histone acetyltransferase activity. The encoded protein forms a heterodimer with ARNTL (BMAL1) that binds E-box enhancer elements upstream of Period (PER1, PER2, PER3) and Cryptochrome (CRY1, CRY2) genes and activates transcription of these genes. PER and CRY proteins heterodimerize and repress their own transcription by interacting in a feedback loop with CLOCK/ARNTL complexes. Polymorphisms in this gene may be associated with behavioral changes in certain populations and with obesity and metabolic syndrome. Alternative splicing results in multiple transcript variants.

anti-KAT13D / CLOCK

YF-PA25368 50 ul
EUR 334
Description: Mouse polyclonal to KAT13D / CLOCK

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Per3 ELISA Kit| Rat Period circadian protein homolog 3 ELISA Ki

EF019147 96 Tests
EUR 689

High Sensitive for Period Circadian Protein 1 (PER1)ELISA kit

HEM012Hu-10x96wellstestplate 10x96-wells test plate
EUR 5693.62
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive for Period Circadian Protein 1 (PER1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • In
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Period Circadian Protein 1 (PER1) in Tissue homogenates, cell lysates and other biological fluids.

High Sensitive for Period Circadian Protein 1 (PER1)ELISA kit

HEM012Hu-1x48wellstestplate 1x48-wells test plate
EUR 556.53
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive for Period Circadian Protein 1 (PER1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • In
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Period Circadian Protein 1 (PER1) in Tissue homogenates, cell lysates and other biological fluids.

High Sensitive for Period Circadian Protein 1 (PER1)ELISA kit

HEM012Hu-1x96wellstestplate 1x96-wells test plate
EUR 752.19
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive for Period Circadian Protein 1 (PER1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • In
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Period Circadian Protein 1 (PER1) in Tissue homogenates, cell lysates and other biological fluids.

High Sensitive for Period Circadian Protein 1 (PER1)ELISA kit

HEM012Hu-5x96wellstestplate 5x96-wells test plate
EUR 3084.86
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive for Period Circadian Protein 1 (PER1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • In
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Period Circadian Protein 1 (PER1) in Tissue homogenates, cell lysates and other biological fluids.

High Sensitive ELISA Kit for Period Circadian Protein 1 (PER1)

4-HEM012Hu
  • EUR 5744.00
  • EUR 3035.00
  • EUR 753.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Period Circadian Protein 1 elisa. Alternative names of the recognized antigen: PER
  • RIGUI
  • hPER
  • Circadian clock protein PERIOD 1
  • Circadian pacemaker protein Rigui
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of High Sensitive Period Circadian Protein 1 (PER1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Rat Period circadian protein homolog 2 (PER2)

KTE100484-48T 48T
EUR 332
  • PER2 is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomoto
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Period circadian protein homolog 2 (PER2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Period circadian protein homolog 2 (PER2)

KTE100484-5platesof96wells 5 plates of 96 wells
EUR 2115
  • PER2 is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomoto
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Period circadian protein homolog 2 (PER2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Period circadian protein homolog 2 (PER2)

KTE100484-96T 96T
EUR 539
  • PER2 is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomoto
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Period circadian protein homolog 2 (PER2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Period circadian protein homolog 1 (PER1)

KTE61248-48T 48T
EUR 332
  • PER1 is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomoto
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Period circadian protein homolog 1 (PER1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Period circadian protein homolog 1 (PER1)

KTE61248-5platesof96wells 5 plates of 96 wells
EUR 2115
  • PER1 is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomoto
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Period circadian protein homolog 1 (PER1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Period circadian protein homolog 1 (PER1)

KTE61248-96T 96T
EUR 539
  • PER1 is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomoto
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Period circadian protein homolog 1 (PER1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Mouse Clock Control/blocking peptide # 1

CLO11-P 100 ug
EUR 164

Rabbit Anti-Mouse Clock Antiserum # 1

CLO11-S 100 ul
EUR 457

Clock sgRNA CRISPR Lentivector set (Mouse)

K3991501 3 x 1.0 ug
EUR 339

Immortalized Mouse Hepatocyte SIMH (CLOCK) Cells

T0750 1x106 cells / 1.0 ml Ask for price

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Mouse CLOCK(Circadian Locomoter Output Cycles Protein Kaput) ELISA Kit