Mouse CLOCK(Circadian Locomoter Output Cycles Protein Kaput) ELISA Kit

Mouse CLOCK(Circadian Locomoter Output Cycles Protein Kaput) ELISA Kit

Circadian Locomoter Output Cycles Protein Kaput (Clock) Antibody
20-abx013288	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Circadian Locomoter Output Cycles Protein Kaput (CLOCK) Antibody
20-abx321582	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Circadian Locomoter Output Cycles Protein Kaput (CLOCK) Antibody
20-abx328613	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Circadian Locomoter Output Cycles Protein Kaput (CLOCK) Antibody
abx431169-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Circadian Locomoter Output Cycles Protein Kaput (CLOCK) Antibody
20-abx302600	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Circadian Locomoter Output Cycles Protein Kaput (CLOCK) Antibody
abx231769-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Circadian Locomoter Output Cycles Protein Kaput (CLOCK) Antibody
20-abx171753	Abbexa	EUR 926.00 EUR 467.00	1 mg 200 ug
Please enquire.

Mouse Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit
E03C1807-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit
E03C1807-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit
E03C1807-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Circadian Locomoter Output Cycles Protein Kaput (CLOCK) ELISA Kit
20-abx258674	Abbexa	EUR 7504.00 EUR 3996.00 EUR 926.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Circadian Locomoter Output Cycles Protein Kaput (CLOCK) ELISA Kit
SEQ116Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5333.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Circadian Locomoter Output Cycles Protein Kaput (CLOCK) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Circadian Locomoter Output Cycles Protein Kaput (CLOCK) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Circadian Locomoter Output Cycles Protein Kaput (CLOCK) ELISA Kit
SEQ116Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 526.89
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Circadian Locomoter Output Cycles Protein Kaput (CLOCK) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Circadian Locomoter Output Cycles Protein Kaput (CLOCK) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Circadian Locomoter Output Cycles Protein Kaput (CLOCK) ELISA Kit
SEQ116Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 709.84
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Circadian Locomoter Output Cycles Protein Kaput (CLOCK) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Circadian Locomoter Output Cycles Protein Kaput (CLOCK) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Circadian Locomoter Output Cycles Protein Kaput (CLOCK) ELISA Kit
SEQ116Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2894.28
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Circadian Locomoter Output Cycles Protein Kaput (CLOCK) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Circadian Locomoter Output Cycles Protein Kaput (CLOCK) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Circadian Locomoter Output Cycles Protein Kaput (CLOCK) ELISA Kit
4-SEQ116Mu	Cloud-Clone	EUR 5384.00 EUR 2845.00 EUR 710.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Circadian Locomoter Output Cycles Protein Kaput elisa. Alternative names of the recognized antigen: KAT13D bHLHe8 Class E basic helix-loop-helix protein 8
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Circadian Locomoter Output Cycles Protein Kaput (CLOCK) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Circadian Locomoter Output Cycles Protein Kaput (CLOCK) CLIA Kit
20-abx496160	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Circadian Locomoter Output Cycles Protein Kaput (CLOCK) Antibody (HRP)
20-abx316830	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Circadian Locomoter Output Cycles Protein Kaput (CLOCK) Antibody (FITC)
20-abx316831	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Circadian Locomoter Output Cycles Protein Kaput (CLOCK) Antibody (Biotin)
20-abx316832	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Goat Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit
E06C1807-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit
E06C1807-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit
E06C1807-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit
E02C1807-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit
E02C1807-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit
E02C1807-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit
E04C1807-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit
E04C1807-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit
E04C1807-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit
E01C1807-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit
E01C1807-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit
E01C1807-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit
E07C1807-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit
E07C1807-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit
E07C1807-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit
E08C1807-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit
E08C1807-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit
E08C1807-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit
E09C1807-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit
E09C1807-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit
E09C1807-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Circadian Locomoter Output Cycles Protein Kaput ELISA Kit (CLOCK)
RK01134	Abclonal	96 Tests	EUR 521

Human Circadian Locomoter Output Cycles Protein Kaput (CLOCK) ELISA Kit
SEQ116Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5189.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Circadian Locomoter Output Cycles Protein Kaput (CLOCK) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Circadian Locomoter Output Cycles Protein Kaput (CLOCK) in tissue homogenates, cell lysates and other biological fluids.

Human Circadian Locomoter Output Cycles Protein Kaput (CLOCK) ELISA Kit
SEQ116Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 515.03
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Circadian Locomoter Output Cycles Protein Kaput (CLOCK) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Circadian Locomoter Output Cycles Protein Kaput (CLOCK) in tissue homogenates, cell lysates and other biological fluids.

Human Circadian Locomoter Output Cycles Protein Kaput (CLOCK) ELISA Kit
SEQ116Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 692.9
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Circadian Locomoter Output Cycles Protein Kaput (CLOCK) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Circadian Locomoter Output Cycles Protein Kaput (CLOCK) in tissue homogenates, cell lysates and other biological fluids.

Human Circadian Locomoter Output Cycles Protein Kaput (CLOCK) ELISA Kit
SEQ116Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2818.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Circadian Locomoter Output Cycles Protein Kaput (CLOCK) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Circadian Locomoter Output Cycles Protein Kaput (CLOCK) in tissue homogenates, cell lysates and other biological fluids.

Human Circadian Locomoter Output Cycles Protein Kaput (CLOCK) ELISA Kit
4-SEQ116Hu	Cloud-Clone	EUR 5240.00 EUR 2769.00 EUR 693.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Circadian Locomoter Output Cycles Protein Kaput elisa. Alternative names of the recognized antigen: KAT13D bHLHe8 Class E basic helix-loop-helix protein 8
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Circadian Locomoter Output Cycles Protein Kaput (CLOCK) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Mouse CLOCK (Circadian Locomoter Output Cycles Protein Kaput)
ELK8166	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Circadian Locomoter Output Cycles Protein Kaput (CLOCK). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated Show more
Description: A sandwich ELISA kit for detection of Circadian Locomoter Output Cycles Protein Kaput from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Guinea pig Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit
E05C1807-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit
E05C1807-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Circadian locomoter output cycles protein kaput(CLOCK) ELISA kit
E05C1807-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Circadian locomoter output cycles protein kaput(CLOCK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human CLOCK (Circadian Locomoter Output Cycles Protein Kaput)
ELK6572	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Circadian Locomoter Output Cycles Protein Kaput (CLOCK). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated Show more
Description: A sandwich ELISA kit for detection of Circadian Locomoter Output Cycles Protein Kaput from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Clock Homolog (CLOCK) ELISA Kit
DLR-CLOCK-Hu-48T	DL Develop	48T	EUR 554
Should the Human Clock Homolog (CLOCK) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Clock Homolog (CLOCK) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Clock Homolog (CLOCK) ELISA Kit
DLR-CLOCK-Hu-96T	DL Develop	96T	EUR 725
Should the Human Clock Homolog (CLOCK) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Clock Homolog (CLOCK) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Clock Homolog (CLOCK) ELISA Kit
RDR-CLOCK-Hu-48Tests	Reddot Biotech	48 Tests	EUR 589

Human Clock Homolog (CLOCK) ELISA Kit
RDR-CLOCK-Hu-96Tests	Reddot Biotech	96 Tests	EUR 820

Human Clock Homolog (CLOCK) ELISA Kit
RD-CLOCK-Hu-48Tests	Reddot Biotech	48 Tests	EUR 563

Human Clock Homolog (CLOCK) ELISA Kit
RD-CLOCK-Hu-96Tests	Reddot Biotech	96 Tests	EUR 783

Circadian Clock Protein PASD1 (PASD1) Antibody
abx030966-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Circadian Clock Protein PASD1 (PASD1) Antibody
abx030966-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Circadian Clock Protein PASD1 (PASD1) Antibody
abx340216-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Circadian Clock Protein PASD1 (PASD1) Antibody
20-abx302666	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Clock/ Rat Clock ELISA Kit
ELI-50992r	Lifescience Market	96 Tests	EUR 886

Mouse Clock ELISA KIT
ELI-33824m	Lifescience Market	96 Tests	EUR 865

Human Clock Homolog (CLOCK) ELISA Kit
20-abx151098	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Clock Homolog (CLOCK)ELISA Kit
201-12-2901	SunredBio	96 tests	EUR 440
This Clock Homolog ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Clock Homolog(CLOCK)ELISA Kit
QY-E05041	Qayee Biotechnology	96T	EUR 361

Clock ELISA Kit (Mouse) (OKCD02092)
OKCD02092	Aviva Systems Biology	96 Wells	EUR 936
Description: Description of target: Transcriptional activator which forms a core component of the circadian clock. The circadian clock, an internal time-keeping system, regulates various physiological processes through the generation of approximately 24 hour circadian rhythms in gene expression, which are translated into rhythms in metabolism and behavior. It is derived from the Latin roots 'circa' (about) and 'diem' (day) and acts as an important regulator of a wide array of physiological functions including metabolism, sleep, body temperature, blood pressure, endocrine, immune, cardiovascular, and renal function. Consists of two major components: the central clock, residing in the suprachiasmatic nucleus (SCN) of the brain, and the peripheral clocks that are present in nearly every tissue and organ system. Both the central and peripheral clocks can be reset by environmental cues, also known as Zeitgebers (German for 'timegivers'). The predominant Zeitgeber for the central clock is light, which is sensed by retina and signals directly to the SCN. The central clock entrains the peripheral clocks through neuronal and hormonal signals, body temperature and feeding-related cues, aligning all clocks with the external light/dark cycle. Circadian rhythms allow an organism to achieve temporal homeostasis with its environment at the molecular level by regulating gene expression to create a peak of protein expression once every 24 hours to control when a particular physiological process is most active with respect to the solar day. Transcription and translation of core clock components (CLOCK, NPAS2, ARNTL/BMAL1, ARNTL2/BMAL2, PER1, PER2, PER3, CRY1 and CRY2) plays a critical role in rhythm generation, whereas delays imposed by post-translational modifications (PTMs) are important for determining the period (tau) of the rhythms (tau refers to the period of a rhythm and is the length, in time, of one complete cycle). A diurnal rhythm is synchronized with the day/night cycle, while the ultradian and infradian rhythms have a period shorter and longer than 24 hours, respectively. Disruptions in the circadian rhythms contribute to the pathology of cardiovascular diseases, cancer, metabolic syndromes and aging. A transcription/translation feedback loop (TTFL) forms the core of the molecular circadian clock mechanism. Transcription factors, CLOCK or NPAS2 and ARNTL/BMAL1 or ARNTL2/BMAL2, form the positive limb of the feedback loop, act in the form of a heterodimer and activate the transcription of core clock genes and clock-controlled genes (involved in key metabolic processes), harboring E-box elements (5'-CACGTG-3') within their promoters. The core clock genes: PER1/2/3 and CRY1/2 which are transcriptional repressors form the negative limb of the feedback loop and interact with the CLOCK|NPAS2-ARNTL/BMAL1|ARNTL2/BMAL2 heterodimer inhibiting its activity and thereby negatively regulating their own expression. This heterodimer also activates nuclear receptors NR1D1/2 and RORA/B/G, which form a second feedback loop and which activate and repress ARNTL/BMAL1 transcription, respectively. CLOCK has an intrinsic acetyltransferase activity, which enables circadian chromatin remodeling by acetylating histones and nonhistone proteins, including its own partner ARNTL/BMAL1. Regulates the circadian expression of ICAM1, VCAM1, CCL2, THPO and MPL and also acts as an enhancer of the transactivation potential of NF-kappaB. Plays an important role in the homeostatic regulation of sleep. The CLOCK-ARNTL/BMAL1 heterodimer regulates the circadian expression of SERPINE1/PAI1, VWF, B3, CCRN4L/NOC, NAMPT, DBP, MYOD1, PPARGC1A, PPARGC1B, SIRT1, GYS2, F7, NGFR, GNRHR, BHLHE40/DEC1, ATF4, MTA1, KLF10 and also genes implicated in glucose and lipid metabolism. Represses glucocorticoid receptor NR3C1/GR-induced transcriptional activity by reducing the association of NR3C1/GR to glucocorticoid response elements (GREs) via the acetylation of multiple lysine residues located in its hinge region. Promotes rhythmic chromatin opening, regulating the DNA accessibility of other transcription factors. May play a role in spermatogenesis; contributes to the chromatoid body assembly and physiology. The CLOCK-ARNTL2/BMAL2 heterodimer activates the transcription of SERPINE1/PAI1 and BHLHE40/DEC1.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.063 ng/mL

Human Clock Homolog (CLOCK) Protein
20-abx650822	Abbexa	EUR 634.00 EUR 272.00 EUR 1929.00 EUR 759.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Clock Cell ELISA Kit
abx595660-96tests	Abbexa	96 tests	EUR 637
Shipped within 1-2 weeks.

Chicken CLOCK ELISA KIT
ELI-09126c	Lifescience Market	96 Tests	EUR 928

CLOCK ELISA KIT|Human
EF008732	Lifescience Market	96 Tests	EUR 689

Human CLOCK ELISA KIT
ELI-50183h	Lifescience Market	96 Tests	EUR 824

Human Clock Homolog (CLOCK) CLIA Kit
20-abx496159	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Period Circadian Protein 1(PER1)ELISA kit
GA-E0899MS-48T	GenAsia Biotech	48T	EUR 336

Mouse Period Circadian Protein 1(PER1)ELISA kit
GA-E0899MS-96T	GenAsia Biotech	96T	EUR 534

Mouse Period Circadian Protein 1(PER1)ELISA kit
QY-E21151	Qayee Biotechnology	96T	EUR 361

Clock Homolog (CLOCK) Antibody
20-abx131224	Abbexa	EUR 453.00 EUR 133.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Recombinant Clock Homolog (CLOCK)
4-RPQ116Hu01	Cloud-Clone	EUR 454.82 EUR 224.00 EUR 1430.56 EUR 543.52 EUR 987.04 EUR 367.00 EUR 3426.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O15516 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 44.0kDa Isoelectric Point: Inquire
Description: Recombinant Human Circadian Locomoter Output Cycles Protein Kaput expressed in: E.coli

Mouse Period circadian protein homolog 2, Per2 ELISA KIT
ELI-14631m	Lifescience Market	96 Tests	EUR 865

Mouse Period circadian protein homolog 3, Per3 ELISA KIT
ELI-14632m	Lifescience Market	96 Tests	EUR 865

Mouse Period circadian protein homolog 1, Per1 ELISA KIT
ELI-44921m	Lifescience Market	96 Tests	EUR 865

Mouse Period Circadian Protein Homolog 3 (PER3) ELISA Kit
abx390189-96tests	Abbexa	96 tests	EUR 911
Shipped within 20 working days.

CLOCK ELISA Kit (Human) (OKCD01088)
OKCD01088	Aviva Systems Biology	96 Wells	EUR 909
Description: Description of target: Transcriptional activator which forms a core component of the circadian clock. The circadian clock, an internal time-keeping system, regulates various physiological processes through the generation of approximately 24 hour circadian rhythms in gene expression, which are translated into rhythms in metabolism and behavior. It is derived from the Latin roots 'circa' (about) and 'diem' (day) and acts as an important regulator of a wide array of physiological functions including metabolism, sleep, body temperature, blood pressure, endocrine, immune, cardiovascular, and renal function. Consists of two major components: the central clock, residing in the suprachiasmatic nucleus (SCN) of the brain, and the peripheral clocks that are present in nearly every tissue and organ system. Both the central and peripheral clocks can be reset by environmental cues, also known as Zeitgebers (German for 'timegivers'). The predominant Zeitgeber for the central clock is light, which is sensed by retina and signals directly to the SCN. The central clock entrains the peripheral clocks through neuronal and hormonal signals, body temperature and feeding-related cues, aligning all clocks with the external light/dark cycle. Circadian rhythms allow an organism to achieve temporal homeostasis with its environment at the molecular level by regulating gene expression to create a peak of protein expression once every 24 hours to control when a particular physiological process is most active with respect to the solar day. Transcription and translation of core clock components (CLOCK, NPAS2, ARNTL/BMAL1, ARNTL2/BMAL2, PER1, PER2, PER3, CRY1 and CRY2) plays a critical role in rhythm generation, whereas delays imposed by post-translational modifications (PTMs) are important for determining the period (tau) of the rhythms (tau refers to the period of a rhythm and is the length, in time, of one complete cycle). A diurnal rhythm is synchronized with the day/night cycle, while the ultradian and infradian rhythms have a period shorter and longer than 24 hours, respectively. Disruptions in the circadian rhythms contribute to the pathology of cardiovascular diseases, cancer, metabolic syndromes and aging. A transcription/translation feedback loop (TTFL) forms the core of the molecular circadian clock mechanism. Transcription factors, CLOCK or NPAS2 and ARNTL/BMAL1 or ARNTL2/BMAL2, form the positive limb of the feedback loop, act in the form of a heterodimer and activate the transcription of core clock genes and clock-controlled genes (involved in key metabolic processes), harboring E-box elements (5'-CACGTG-3') within their promoters. The core clock genes: PER1/2/3 and CRY1/2 which are transcriptional repressors form the negative limb of the feedback loop and interact with the CLOCK|NPAS2-ARNTL/BMAL1|ARNTL2/BMAL2 heterodimer inhibiting its activity and thereby negatively regulating their own expression. This heterodimer also activates nuclear receptors NR1D1/2 and RORA/B/G, which form a second feedback loop and which activate and repress ARNTL/BMAL1 transcription, respectively. CLOCK has an intrinsic acetyltransferase activity, which enables circadian chromatin remodeling by acetylating histones and nonhistone proteins, including its own partner ARNTL/BMAL1. Regulates the circadian expression of ICAM1, VCAM1, CCL2, THPO and MPL and also acts as an enhancer of the transactivation potential of NF-kappaB. Plays an important role in the homeostatic regulation of sleep. The CLOCK-ARNTL/BMAL1 heterodimer regulates the circadian expression of SERPINE1/PAI1, VWF, B3, CCRN4L/NOC, NAMPT, DBP, MYOD1, PPARGC1A, PPARGC1B, SIRT1, GYS2, F7, NGFR, GNRHR, BHLHE40/DEC1, ATF4, MTA1, KLF10 and also genes implicated in glucose and lipid metabolism. Represses glucocorticoid receptor NR3C1/GR-induced transcriptional activity by reducing the association of NR3C1/GR to glucocorticoid response elements (GREs) via the acetylation of multiple lysine residues located in its hinge region. Promotes rhythmic chromatin opening, regulating the DNA accessibility of other transcription factors. The CLOCK-ARNTL2/BMAL2 heterodimer activates the transcription of SERPINE1/PAI1 and BHLHE40/DEC1.7 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.8"Histone acetyltransferase-dependent chromatin remodeling and the vascular clock."_x005F_x005F_x000D_Curtis A.M., Seo S.B., Westgate E.J., Rudic R.D., Smyth E.M., Chakravarti D., FitzGerald G.A., McNamara P._x005F_x005F_x000D_J. Biol. Chem. 279:7091-7097(2004) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, INTERACTION WITH KAT2B; CREBBP AND EP300.Ref.10"CLOCK/BMAL1 regulates human nocturnin transcription through binding to the E-box of nocturnin promoter."_x005F_x005F_x000D_Li R., Yue J., Zhang Y., Zhou L., Hao W., Yuan J., Qiang B., Ding J.M., Peng X., Cao J.M._x005F_x005F_x000D_Mol. Cell. Biochem. 317:169-177(2008) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.13"Peripheral CLOCK regulates target-tissue glucocorticoid receptor transcriptional activity in a circadian fashion in man."_x005F_x005F_x000D_Charmandari E., Chrousos G.P., Lambrou G.I., Pavlaki A., Koide H., Ng S.S., Kino T._x005F_x005F_x000D_PLoS ONE 6:E25612-E25612(2011) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, INTERACTION WITH NR3C1.Ref.14"A DNA damage response screen identifies RHINO, a 9-1-1 and TopBP1 interacting protein required for ATR signaling."_x005F_x005F_x000D_Cotta-Ramusino C., McDonald E.R. III, Hurov K., Sowa M.E., Harper J.W., Elledge S.J._x005F_x005F_x000D_Science 332:1313-1317(2011) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION.Ref.16"Diurnal expression of the thrombopoietin gene is regulated by CLOCK."_x005F_x005F_x000D_Tracey C.J., Pan X., Catterson J.H., Harmar A.J., Hussain M.M., Hartley P.S._x005F_x005F_x000D_J. Thromb. Haemost. 10:662-669(2012) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.19"p75 neurotrophin receptor is a clock gene that regulates oscillatory components of circadian and metabolic networks."_x005F_x005F_x000D_Baeza-Raja B., Eckel-Mahan K., Zhang L., Vagena E., Tsigelny I.F., Sassone-Corsi P., Ptacek L.J., Akassoglou K._x005F_x005F_x000D_J. Neurosci. 33:10221-10234(2013) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.22"A meeting of two chronobiological systems: circadian proteins Period1 and BMAL1 modulate the human hair cycle clock."_x005F_x005F_x000D_Al-Nuaimi Y., Hardman J.A., Biro T., Haslam I.S., Philpott M.P., Toth B.I., Farjo N., Farjo B., Baier G., Watson R.E., Grimaldi B., Kloepper J.E., Paus R._x005F_x005F_x000D_J. Invest. Dermatol. 134:610-619(2014) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, TISSUE SPECIFICITY. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.117 ng/mL

CLOCK ELISA Kit (Human) (OKAN04742)
OKAN04742	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: The protein encoded by this gene plays a central role in the regulation of circadian rhythms. The protein encodes a transcription factor of the basic helix-loop-helix (bHLH) family and contains DNA binding histone acetyltransferase activity. The encoded protein forms a heterodimer with ARNTL (BMAL1) that binds E-box enhancer elements upstream of Period (PER1, PER2, PER3) and Cryptochrome (CRY1, CRY2) genes and activates transcription of these genes. PER and CRY proteins heterodimerize and repress their own transcription by interacting in a feedback loop with CLOCK/ARNTL complexes. Polymorphisms in this gene may be associated with behavioral changes in certain populations and with obesity and metabolic syndrome. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.117 ng/mL

CLOCK ELISA Kit (Human) (OKEH08376)
OKEH08376	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: The protein encoded by this gene plays a central role in the regulation of circadian rhythms. The protein encodes a transcription factor of the basic helix-loop-helix (bHLH) family and contains DNA binding histone acetyltransferase activity. The encoded protein forms a heterodimer with ARNTL (BMAL1) that binds E-box enhancer elements upstream of Period (PER1, PER2, PER3) and Cryptochrome (CRY1, CRY2) genes and activates transcription of these genes. PER and CRY proteins heterodimerize and repress their own transcription by interacting in a feedback loop with CLOCK/ARNTL complexes. Polymorphisms in this gene may be associated with behavioral changes in certain populations and with obesity and metabolic syndrome. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.089ng/mL

Per3 ELISA Kit| Mouse Period circadian protein homolog 3 ELISA
EF015828	Lifescience Market	96 Tests	EUR 689

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Mouse CLOCK shRNA Plasmid
20-abx969707	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Clock Homolog (CLOCK) Polyclonal Antibody (Human)
4-PAQ116Hu01	Cloud-Clone	EUR 262.00 EUR 2747.00 EUR 679.00 EUR 331.00 EUR 220.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLOCK (Ala34~Ala379) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Clock Homolog (CLOCK)

Human Period Circadian Protein 1 (PER1) ELISA Kit
20-abx585343	Abbexa	EUR 7645.00 EUR 4074.00 EUR 942.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Period Circadian Protein 2 (PER2) ELISA Kit
20-abx155964	Abbexa	EUR 7911.00 EUR 4215.00 EUR 973.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Period Circadian Protein 1 (PER1) ELISA Kit
20-abx152702	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Period Circadian Protein 1 (PER1)ELISA kit
201-12-3257	SunredBio	96 tests	EUR 440
This Period Circadian Protein 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Period Circadian Protein 1 (PER1) ELISA Kit
DLR-PER1-Hu-48T	DL Develop	48T	EUR 554
Should the Human Period Circadian Protein 1 (PER1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Period Circadian Protein 1 (PER1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Period Circadian Protein 1 (PER1) ELISA Kit
DLR-PER1-Hu-96T	DL Develop	96T	EUR 725
Should the Human Period Circadian Protein 1 (PER1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Period Circadian Protein 1 (PER1) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Period Circadian Protein 2 (PER2) ELISA Kit
DLR-PER2-Ra-48T	DL Develop	48T	EUR 590
Should the Rat Period Circadian Protein 2 (PER2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Period Circadian Protein 2 (PER2) in samples from tissue homogenates or other biological fluids.

Rat Period Circadian Protein 2 (PER2) ELISA Kit
DLR-PER2-Ra-96T	DL Develop	96T	EUR 774
Should the Rat Period Circadian Protein 2 (PER2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Period Circadian Protein 2 (PER2) in samples from tissue homogenates or other biological fluids.

Human Period Circadian Protein 1 ELISA Kit (PER1)
RK02058	Abclonal	96 Tests	EUR 521

Human Period Circadian Protein 1 (PER1) ELISA Kit
RD-PER1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 563

Human Period Circadian Protein 1 (PER1) ELISA Kit
RD-PER1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 783

Rat Period Circadian Protein 2 (PER2) ELISA Kit
RD-PER2-Ra-48Tests	Reddot Biotech	48 Tests	EUR 603

Rat Period Circadian Protein 2 (PER2) ELISA Kit
RD-PER2-Ra-96Tests	Reddot Biotech	96 Tests	EUR 840

Human Period Circadian Protein 1 (PER1) ELISA Kit
RDR-PER1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 589

Human Period Circadian Protein 1 (PER1) ELISA Kit
RDR-PER1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 820

Rat Period Circadian Protein 2 (PER2) ELISA Kit
RDR-PER2-Ra-48Tests	Reddot Biotech	48 Tests	EUR 631

Rat Period Circadian Protein 2 (PER2) ELISA Kit
RDR-PER2-Ra-96Tests	Reddot Biotech	96 Tests	EUR 880

Human Period Circadian Protein 1(PER1)ELISA Kit
QY-E02797	Qayee Biotechnology	96T	EUR 361

Rat Period Circadian Protein 1(PER1)ELISA kit
QY-E10554	Qayee Biotechnology	96T	EUR 361

Human Period Circadian Protein 1 (PER1) ELISA Kit
SEM012Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5189.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Period Circadian Protein 1 (PER1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Period Circadian Protein 1 (PER1) in Tissue homogenates, cell lysates and other biological fluids.

Human Period Circadian Protein 1 (PER1) ELISA Kit
SEM012Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 515.03
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Period Circadian Protein 1 (PER1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Period Circadian Protein 1 (PER1) in Tissue homogenates, cell lysates and other biological fluids.

Human Period Circadian Protein 1 (PER1) ELISA Kit
SEM012Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 692.9
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Period Circadian Protein 1 (PER1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Period Circadian Protein 1 (PER1) in Tissue homogenates, cell lysates and other biological fluids.

Human Period Circadian Protein 1 (PER1) ELISA Kit
SEM012Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2818.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Period Circadian Protein 1 (PER1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Period Circadian Protein 1 (PER1) in Tissue homogenates, cell lysates and other biological fluids.

Human Period Circadian Protein 1 (PER1) ELISA Kit
4-SEM012Hu	Cloud-Clone	EUR 5240.00 EUR 2769.00 EUR 693.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Period Circadian Protein 1 elisa. Alternative names of the recognized antigen: PER RIGUI hPER Circadian clock protein PERIOD 1 Circadian pacemaker protein Rigui
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Period Circadian Protein 1 (PER1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Period Circadian Protein 2 (PER2) ELISA Kit
SEM013Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5621.62
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Period Circadian Protein 2 (PER2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Period Circadian Protein 2 (PER2) in Tissue homogenates and other biological fluids.

Rat Period Circadian Protein 2 (PER2) ELISA Kit
SEM013Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 550.6
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Period Circadian Protein 2 (PER2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Period Circadian Protein 2 (PER2) in Tissue homogenates and other biological fluids.

Rat Period Circadian Protein 2 (PER2) ELISA Kit
SEM013Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 743.72
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Period Circadian Protein 2 (PER2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Period Circadian Protein 2 (PER2) in Tissue homogenates and other biological fluids.

Rat Period Circadian Protein 2 (PER2) ELISA Kit
SEM013Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 3046.74
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Period Circadian Protein 2 (PER2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Period Circadian Protein 2 (PER2) in Tissue homogenates and other biological fluids.

Rat Period Circadian Protein 2 (PER2) ELISA Kit
4-SEM013Ra	Cloud-Clone	EUR 5672.00 EUR 2997.00 EUR 744.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Period Circadian Protein 2 elisa. Alternative names of the recognized antigen: FASPS Circadian clock protein PERIOD 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Period Circadian Protein 2 (PER2) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

CLOCK siRNA
20-abx901118	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CLOCK Antibody
BF0128	Affbiotech	200ul	EUR 376
Description: CLOCK antibody detects endogenous levels of total CLOCK.

Clock Antibody
AF0323	Affbiotech	200ul	EUR 304
Description: Clock antibody detects endogenous levels of total Clock.

Clock Antibody
ABF0323	Lifescience Market	100 ug	EUR 438

CLOCK siRNA
20-abx912113	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CLOCK siRNA
20-abx912114	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Clock antibody
70R-33701	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal Clock antibody

Clock Antibody
ABD3019	Lifescience Market	100 ug	EUR 438

CLOCK antibody
38677-100ul	SAB	100ul	EUR 252

CLOCK Antibody
3896-100	Biovision		EUR 316

CLOCK Antibody
3896-30T	Biovision		EUR 146

CLOCK ) Antibody
39300-100ul	SAB	100ul	EUR 390

Clock Antibody
33580-100ul	SAB	100ul	EUR 252

Clock Antibody
33580-50ul	SAB	50ul	EUR 187

CLOCK Antibody
49586-100ul	SAB	100ul	EUR 333

CLOCK Antibody
49586-50ul	SAB	50ul	EUR 239

CLOCK antibody
10R-1414	Fitzgerald	100 ug	EUR 512
Description: Mouse monoclonal CLOCK antibody

CLOCK antibody
10R-1897	Fitzgerald	100 ul	EUR 381
Description: Mouse monoclonal CLOCK antibody

CLOCK antibody
70R-12173	Fitzgerald	100 ug	EUR 403
Description: Rabbit polyclonal CLOCK antibody

Clock Antibody
DF3019	Affbiotech	200ul	EUR 304
Description: Clock Antibody detects endogenous levels of total Clock.

CLOCK Antibody
1-CSB-PA001722	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CLOCK. Recognizes CLOCK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

CLOCK Antibody
1-CSB-PA005574EA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CLOCK. Recognizes CLOCK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

CLOCK Antibody
1-CSB-PA005574ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CLOCK. Recognizes CLOCK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

Clock Homolog (CLOCK) Polyclonal Antibody (Human), APC
4-PAQ116Hu01-APC	Cloud-Clone	EUR 368.00 EUR 3599.00 EUR 993.00 EUR 472.00 EUR 229.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLOCK (Ala34~Ala379) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Clock Homolog (CLOCK). This antibody is labeled with APC.

Clock Homolog (CLOCK) Polyclonal Antibody (Human), Biotinylated
4-PAQ116Hu01-Biotin	Cloud-Clone	EUR 328.00 EUR 2697.00 EUR 786.00 EUR 404.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLOCK (Ala34~Ala379) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Clock Homolog (CLOCK). This antibody is labeled with Biotin.

Clock Homolog (CLOCK) Polyclonal Antibody (Human), Cy3
4-PAQ116Hu01-Cy3	Cloud-Clone	EUR 449.00 EUR 4757.00 EUR 1283.00 EUR 588.00 EUR 264.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLOCK (Ala34~Ala379) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Clock Homolog (CLOCK). This antibody is labeled with Cy3.

Clock Homolog (CLOCK) Polyclonal Antibody (Human), FITC
4-PAQ116Hu01-FITC	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLOCK (Ala34~Ala379) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Clock Homolog (CLOCK). This antibody is labeled with FITC.

Clock Homolog (CLOCK) Polyclonal Antibody (Human), HRP
4-PAQ116Hu01-HRP	Cloud-Clone	EUR 335.00 EUR 3135.00 EUR 877.00 EUR 426.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLOCK (Ala34~Ala379) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Clock Homolog (CLOCK). This antibody is labeled with HRP.

Clock Homolog (CLOCK) Polyclonal Antibody (Human), PE
4-PAQ116Hu01-PE	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLOCK (Ala34~Ala379) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Clock Homolog (CLOCK). This antibody is labeled with PE.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

Clock ORF Vector (Mouse) (pORF)
ORF041591	ABM	1.0 ug DNA	EUR 506

Human PER1( Period circadian protein homolog 1) ELISA Kit
EH11018	FN Test	96T	EUR 567.6
Detection range: 15.625-1000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Human PER2(Period circadian protein homolog 2) ELISA Kit
EH11019	FN Test	96T	EUR 567.6
Detection range: 0.313-20 ng/ml Uniprot ID: O15055
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Period circadian protein homolog 2, PER2 ELISA KIT
ELI-20905h	Lifescience Market	96 Tests	EUR 824

Chicken Period circadian protein homolog 2, PER2 ELISA KIT
ELI-15153c	Lifescience Market	96 Tests	EUR 928

Human Period circadian protein homolog 1, PER1 ELISA KIT
ELI-16042h	Lifescience Market	96 Tests	EUR 824

ELISA kit for Human PER1 (Period Circadian Protein 1)
ELK6571	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Period Circadian Protein 1 (PER1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Show more
Description: A sandwich ELISA kit for detection of Period Circadian Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat Period circadian protein homolog 1, Per1 ELISA KIT
ELI-37426r	Lifescience Market	96 Tests	EUR 886

Human Period circadian protein homolog 3, PER3 ELISA KIT
ELI-43670h	Lifescience Market	96 Tests	EUR 824

ELISA kit for Rat PER2 (Period Circadian Protein 2)
ELK8024	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Period Circadian Protein 2 (PER2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Show more
Description: A sandwich ELISA kit for detection of Period Circadian Protein 2 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Period circadian protein homolog 2 (PER32) ELISA Kit
abx382155-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Period Circadian Protein Homolog 3 (PER3) ELISA Kit
abx382156-96tests	Abbexa	96 tests	EUR 911
Shipped within 20 working days.

Rat Period Circadian Protein Homolog 3 (PER3) ELISA Kit
abx391787-96tests	Abbexa	96 tests	EUR 911
Shipped within 20 working days.

CLOCK Protein Vector (Mouse) (pPB-C-His)
PV166362	ABM	500 ng	EUR 1065

CLOCK Protein Vector (Mouse) (pPB-N-His)
PV166363	ABM	500 ng	EUR 1065

CLOCK Protein Vector (Mouse) (pPM-C-HA)
PV166364	ABM	500 ng	EUR 1065

CLOCK Protein Vector (Mouse) (pPM-C-His)
PV166365	ABM	500 ng	EUR 1065

Clock Colorimetric Cell-Based ELISA Kit (OKAG01149)
OKAG01149	Aviva Systems Biology	96 Wells	EUR 596
Description: Description of target: ;Species reactivity: Human, Mouse, Rat;Application: ELISA;Assay info: Assay Type: Cell-Based Subtype: None Detection Method: Colorimetric 450 nm;Sensitivity:

Clock Colorimetric Cell-Based ELISA
EKC1630	BosterBio	100ul	EUR 572

Clock Homolog (CLOCK) Polyclonal Antibody (Human), APC-Cy7
4-PAQ116Hu01-APC-Cy7	Cloud-Clone	EUR 616.00 EUR 7078.00 EUR 1867.00 EUR 824.00 EUR 338.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLOCK (Ala34~Ala379) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Clock Homolog (CLOCK). This antibody is labeled with APC-Cy7.

Polyclonal CLOCK Antibody
AMM05779G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CLOCK . This antibody is tested and proven to work in the following applications:

CLOCK Conjugated Antibody
C49586	SAB	100ul	EUR 397

CLOCK Blocking Peptide
BF0128-BP	Affbiotech	1mg	EUR 195

Clock Conjugated Antibody
C33580	SAB	100ul	EUR 397

Clock Blocking Peptide
AF0323-BP	Affbiotech	1mg	EUR 195

CLOCK cloning plasmid
CSB-CL005574HU-10ug	Cusabio	10ug	EUR 821
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2541 Sequence: atgttgtttaccgtaagctgtagtaaaatgagctcgattgttgacagagatgacagtagtatttttgatgggttggtggaagaagatgacaaggacaaagcgaaaagagtatctagaaacaaatctgaaaagaaacgtagagatcaatttaatgttctcattaaagaactgggat Show more
Description: A cloning plasmid for the CLOCK gene.

anti- CLOCK antibody
FNab01769	FN Test	100µg	EUR 505.25
Immunogen: clock homolog(Mouse) Uniprot ID: O15516 Gene ID: 9575 Research Area: Epigenetics, Signal Transduction, Metabolism, Cardiovascular, Neuroscience
Description: Antibody raised against CLOCK

Clock Polyclonal Antibody
ES2004-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Clock from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Clock Polyclonal Antibody
ES2004-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Clock from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

CLOCK Blocking Peptide
20-abx161360	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

Clock Polyclonal Antibody
ABP51005-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the Internal region of human Clock at AA range: 210-290 Applications tips:
Description: A polyclonal antibody for detection of Clock from Human, Mouse, Rat. This Clock antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Clock at AA range: 210-290

Clock Polyclonal Antibody
ABP51005-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the Internal region of human Clock at AA range: 210-290 Applications tips:
Description: A polyclonal antibody for detection of Clock from Human, Mouse, Rat. This Clock antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Clock at AA range: 210-290

Clock Polyclonal Antibody
ABP51005-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the Internal region of human Clock at AA range: 210-290 Applications tips:
Description: A polyclonal antibody for detection of Clock from Human, Mouse, Rat. This Clock antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Clock at AA range: 210-290

CLOCK Rabbit pAb
A5633-100ul	Abclonal	100 ul	EUR 308

CLOCK Rabbit pAb
A5633-200ul	Abclonal	200 ul	EUR 459

CLOCK Rabbit pAb
A5633-20ul	Abclonal	20 ul	EUR 183

CLOCK Rabbit pAb
A5633-50ul	Abclonal	50 ul	EUR 223

CLOCK Blocking Peptide
33R-10985	Fitzgerald	50 ug	EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CLOCK antibody, catalog no. 70R-12173

CLOCK Blocking Peptide
3896BP-50	Biovision		EUR 153

Clock Blocking Peptide
DF3019-BP	Affbiotech	1mg	EUR 195

Anti-CLOCK antibody
PAab01769	Lifescience Market	100 ug	EUR 355

anti-CLOCK (8F7)
LF-MA30382	Abfrontier	100 ul	EUR 445
Description: Mouse Monoclonal to CLOCK

Anti-Clock antibody
STJ92343	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Clock.

Anti-Clock antibody
STJ97961	St John's Laboratory	100 µl	EUR 234
Description: Mouse monoclonal to Clock.

Anti-CLOCK antibody
STJ11100916	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene plays a central role in the regulation of circadian rhythms. The protein encodes a transcription factor of the basic helix-loop-helix (bHLH) family and contains DNA binding histone acetyltransferase activity. The encoded protein forms a heterodimer with ARNTL (BMAL1) that binds E-box enhancer elements upstream of Period (PER1, PER2, PER3) and Cryptochrome (CRY1, CRY2) genes and activates transcription of these genes. PER and CRY proteins heterodimerize and repress their own transcription by interacting in a feedback loop with CLOCK/ARNTL complexes. Polymorphisms in this gene may be associated with behavioral changes in certain populations and with obesity and metabolic syndrome. Alternative splicing results in multiple transcript variants.

anti-KAT13D / CLOCK
YF-PA25368	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to KAT13D / CLOCK

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Per3 ELISA Kit| Rat Period circadian protein homolog 3 ELISA Ki
EF019147	Lifescience Market	96 Tests	EUR 689

High Sensitive for Period Circadian Protein 1 (PER1)ELISA kit
HEM012Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5693.62
The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive for Period Circadian Protein 1 (PER1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% In Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Period Circadian Protein 1 (PER1) in Tissue homogenates, cell lysates and other biological fluids.

High Sensitive for Period Circadian Protein 1 (PER1)ELISA kit
HEM012Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 556.53
The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive for Period Circadian Protein 1 (PER1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% In Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Period Circadian Protein 1 (PER1) in Tissue homogenates, cell lysates and other biological fluids.

High Sensitive for Period Circadian Protein 1 (PER1)ELISA kit
HEM012Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 752.19
The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive for Period Circadian Protein 1 (PER1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% In Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Period Circadian Protein 1 (PER1) in Tissue homogenates, cell lysates and other biological fluids.

High Sensitive for Period Circadian Protein 1 (PER1)ELISA kit
HEM012Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 3084.86
The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive for Period Circadian Protein 1 (PER1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% In Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Period Circadian Protein 1 (PER1) in Tissue homogenates, cell lysates and other biological fluids.

High Sensitive ELISA Kit for Period Circadian Protein 1 (PER1)
4-HEM012Hu	Cloud-Clone	EUR 5744.00 EUR 3035.00 EUR 753.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Period Circadian Protein 1 elisa. Alternative names of the recognized antigen: PER RIGUI hPER Circadian clock protein PERIOD 1 Circadian pacemaker protein Rigui
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of High Sensitive Period Circadian Protein 1 (PER1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Rat Period circadian protein homolog 2 (PER2)
KTE100484-48T	Abbkine	48T	EUR 332
PER2 is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomoto Show more
Description: Quantitative sandwich ELISA for measuring Rat Period circadian protein homolog 2 (PER2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Period circadian protein homolog 2 (PER2)
KTE100484-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
PER2 is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomoto Show more
Description: Quantitative sandwich ELISA for measuring Rat Period circadian protein homolog 2 (PER2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Period circadian protein homolog 2 (PER2)
KTE100484-96T	Abbkine	96T	EUR 539
PER2 is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomoto Show more
Description: Quantitative sandwich ELISA for measuring Rat Period circadian protein homolog 2 (PER2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Period circadian protein homolog 1 (PER1)
KTE61248-48T	Abbkine	48T	EUR 332
PER1 is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomoto Show more
Description: Quantitative sandwich ELISA for measuring Human Period circadian protein homolog 1 (PER1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Period circadian protein homolog 1 (PER1)
KTE61248-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
PER1 is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomoto Show more
Description: Quantitative sandwich ELISA for measuring Human Period circadian protein homolog 1 (PER1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Period circadian protein homolog 1 (PER1)
KTE61248-96T	Abbkine	96T	EUR 539
PER1 is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomoto Show more
Description: Quantitative sandwich ELISA for measuring Human Period circadian protein homolog 1 (PER1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Mouse Clock Control/blocking peptide # 1
CLO11-P	Alpha Diagnostics	100 ug	EUR 164

Rabbit Anti-Mouse Clock Antiserum # 1
CLO11-S	Alpha Diagnostics	100 ul	EUR 457

Clock sgRNA CRISPR Lentivector set (Mouse)
K3991501	ABM	3 x 1.0 ug	EUR 339

Immortalized Mouse Hepatocyte SIMH (CLOCK) Cells
T0750	ABM	1x106 cells / 1.0 ml	Ask for price

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Mouse CLOCK(Circadian Locomoter Output Cycles Protein Kaput) ELISA Kit