Rat HYAL1(Hyaluronoglucosaminidase 1) ELISA Kit

Rat HYAL1(Hyaluronoglucosaminidase 1) ELISA Kit

Rat Hyaluronoglucosaminidase 1 (HYAL1) ELISA Kit

RD-HYAL1-Ra-48Tests 48 Tests
EUR 603

Rat Hyaluronoglucosaminidase 1 (HYAL1) ELISA Kit

RD-HYAL1-Ra-96Tests 96 Tests
EUR 840

Human Hyaluronoglucosaminidase 1 (HYAL1) ELISA Kit

DLR-HYAL1-Hu-48T 48T
EUR 554
  • Should the Human Hyaluronoglucosaminidase 1 (HYAL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Hyaluronoglucosaminidase 1 (HYAL1) in samples from tissue homogenates or other biological fluids.

Human Hyaluronoglucosaminidase 1 (HYAL1) ELISA Kit

DLR-HYAL1-Hu-96T 96T
EUR 725
  • Should the Human Hyaluronoglucosaminidase 1 (HYAL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Hyaluronoglucosaminidase 1 (HYAL1) in samples from tissue homogenates or other biological fluids.

Mouse Hyaluronoglucosaminidase 1 (HYAL1) ELISA Kit

DLR-HYAL1-Mu-48T 48T
EUR 566
  • Should the Mouse Hyaluronoglucosaminidase 1 (HYAL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Hyaluronoglucosaminidase 1 (HYAL1) in samples from tissue homogenates or other biological fluids.

Mouse Hyaluronoglucosaminidase 1 (HYAL1) ELISA Kit

DLR-HYAL1-Mu-96T 96T
EUR 741
  • Should the Mouse Hyaluronoglucosaminidase 1 (HYAL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Hyaluronoglucosaminidase 1 (HYAL1) in samples from tissue homogenates or other biological fluids.

Human Hyaluronoglucosaminidase 1 (HYAL1) ELISA Kit

RDR-HYAL1-Hu-48Tests 48 Tests
EUR 589

Human Hyaluronoglucosaminidase 1 (HYAL1) ELISA Kit

RDR-HYAL1-Hu-96Tests 96 Tests
EUR 820

Mouse Hyaluronoglucosaminidase 1 (HYAL1) ELISA Kit

RDR-HYAL1-Mu-48Tests 48 Tests
EUR 603

Mouse Hyaluronoglucosaminidase 1 (HYAL1) ELISA Kit

RDR-HYAL1-Mu-96Tests 96 Tests
EUR 840

Human Hyaluronoglucosaminidase 1 (HYAL1) ELISA Kit

RD-HYAL1-Hu-48Tests 48 Tests
EUR 563

Human Hyaluronoglucosaminidase 1 (HYAL1) ELISA Kit

RD-HYAL1-Hu-96Tests 96 Tests
EUR 783

Mouse Hyaluronoglucosaminidase 1 (HYAL1) ELISA Kit

RD-HYAL1-Mu-48Tests 48 Tests
EUR 577

Mouse Hyaluronoglucosaminidase 1 (HYAL1) ELISA Kit

RD-HYAL1-Mu-96Tests 96 Tests
EUR 802

Rat Hyaluronoglucosaminidase 1 (HYAL1) ELISA Kit

20-abx155660
  • EUR 7911.00
  • EUR 4215.00
  • EUR 973.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Hyaluronoglucosaminidase 1 (HYAL1) ELISA Kit

SES092Ra-10x96wellstestplate 10x96-wells test plate
EUR 5621.62
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Hyaluronoglucosaminidase 1 (HYAL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Hyaluronoglucosaminidase 1 (HYAL1) in Tissue homogenates and other biological fluids.

Rat Hyaluronoglucosaminidase 1 (HYAL1) ELISA Kit

SES092Ra-1x48wellstestplate 1x48-wells test plate
EUR 550.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Hyaluronoglucosaminidase 1 (HYAL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Hyaluronoglucosaminidase 1 (HYAL1) in Tissue homogenates and other biological fluids.

Rat Hyaluronoglucosaminidase 1 (HYAL1) ELISA Kit

SES092Ra-1x96wellstestplate 1x96-wells test plate
EUR 743.72
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Hyaluronoglucosaminidase 1 (HYAL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Hyaluronoglucosaminidase 1 (HYAL1) in Tissue homogenates and other biological fluids.

Rat Hyaluronoglucosaminidase 1 (HYAL1) ELISA Kit

SES092Ra-5x96wellstestplate 5x96-wells test plate
EUR 3046.74
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Hyaluronoglucosaminidase 1 (HYAL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Hyaluronoglucosaminidase 1 (HYAL1) in Tissue homogenates and other biological fluids.

Rat Hyaluronoglucosaminidase 1 (HYAL1) ELISA Kit

4-SES092Ra
  • EUR 5672.00
  • EUR 2997.00
  • EUR 744.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Hyaluronoglucosaminidase 1 elisa. Alternative names of the recognized antigen: LUCA1
  • NAT6
  • Hyaluronidase-1
  • Lung carcinoma protein 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Hyaluronoglucosaminidase 1 (HYAL1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

ELISA kit for Rat HYAL1 (Hyaluronoglucosaminidase 1)

ELK8062 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Hyaluronoglucosaminidase 1 (HYAL1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of Hyaluronoglucosaminidase 1 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat Hyaluronoglucosaminidase 1 (HYAL1) CLIA Kit

20-abx496246
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Hyaluronoglucosaminidase 1 (HYAL1) Protein

20-abx167627
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Hyaluronoglucosaminidase 1 (HYAL1) ELISA Kit

20-abx055351
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Hyaluronoglucosaminidase 1 (HYAL1) ELISA Kit

20-abx258130
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Cow Hyaluronoglucosaminidase 1 (HYAL1) ELISA Kit

20-abx258685
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Hyaluronoglucosaminidase 1 ELISA Kit (HYAL1)

RK01616 96 Tests
EUR 521

Cattle Hyaluronoglucosaminidase 1 (HYAL1) ELISA Kit

SES092Bo-10x96wellstestplate 10x96-wells test plate
EUR 6197.58
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Hyaluronoglucosaminidase 1 (HYAL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Hyaluronoglucosaminidase 1 (HYAL1) in Tissue homogenates, cell lysates and other biological fluids.

Cattle Hyaluronoglucosaminidase 1 (HYAL1) ELISA Kit

SES092Bo-1x48wellstestplate 1x48-wells test plate
EUR 598.04
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Hyaluronoglucosaminidase 1 (HYAL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Hyaluronoglucosaminidase 1 (HYAL1) in Tissue homogenates, cell lysates and other biological fluids.

Cattle Hyaluronoglucosaminidase 1 (HYAL1) ELISA Kit

SES092Bo-1x96wellstestplate 1x96-wells test plate
EUR 811.48
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Hyaluronoglucosaminidase 1 (HYAL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Hyaluronoglucosaminidase 1 (HYAL1) in Tissue homogenates, cell lysates and other biological fluids.

Cattle Hyaluronoglucosaminidase 1 (HYAL1) ELISA Kit

SES092Bo-5x96wellstestplate 5x96-wells test plate
EUR 3351.66
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Hyaluronoglucosaminidase 1 (HYAL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Hyaluronoglucosaminidase 1 (HYAL1) in Tissue homogenates, cell lysates and other biological fluids.

Cattle Hyaluronoglucosaminidase 1 (HYAL1) ELISA Kit

4-SES092Bo
  • EUR 6248.00
  • EUR 3302.00
  • EUR 812.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Hyaluronoglucosaminidase 1 elisa. Alternative names of the recognized antigen: LUCA1
  • NAT6
  • Hyaluronidase-1
  • Lung carcinoma protein 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Cattle Hyaluronoglucosaminidase 1 (HYAL1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Hyaluronoglucosaminidase 1 (HYAL1) ELISA Kit

SES092Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hyaluronoglucosaminidase 1 (HYAL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hyaluronoglucosaminidase 1 (HYAL1) in serum, plasma, tissue homogenates and other biological fluids.

Human Hyaluronoglucosaminidase 1 (HYAL1) ELISA Kit

SES092Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hyaluronoglucosaminidase 1 (HYAL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hyaluronoglucosaminidase 1 (HYAL1) in serum, plasma, tissue homogenates and other biological fluids.

Human Hyaluronoglucosaminidase 1 (HYAL1) ELISA Kit

SES092Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hyaluronoglucosaminidase 1 (HYAL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hyaluronoglucosaminidase 1 (HYAL1) in serum, plasma, tissue homogenates and other biological fluids.

Human Hyaluronoglucosaminidase 1 (HYAL1) ELISA Kit

SES092Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hyaluronoglucosaminidase 1 (HYAL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hyaluronoglucosaminidase 1 (HYAL1) in serum, plasma, tissue homogenates and other biological fluids.

Human Hyaluronoglucosaminidase 1 (HYAL1) ELISA Kit

4-SES092Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Hyaluronoglucosaminidase 1 elisa. Alternative names of the recognized antigen: LUCA1
  • NAT6
  • Hyaluronidase-1
  • Lung carcinoma protein 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Hyaluronoglucosaminidase 1 (HYAL1) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Hyaluronoglucosaminidase 1 (HYAL1) Antibody

20-abx102757
  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hyaluronoglucosaminidase 1 (HYAL1) Antibody

20-abx102758
  • EUR 467.00
  • EUR 133.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hyaluronoglucosaminidase 1 (HYAL1) Antibody

20-abx130414
  • EUR 481.00
  • EUR 133.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hyaluronoglucosaminidase 1 (HYAL1) Antibody

20-abx172848
  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Hyaluronoglucosaminidase 1 (HYAL1) Antibody

20-abx172849
  • EUR 982.00
  • EUR 495.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Hyaluronoglucosaminidase 1 (HYAL1)

4-RPS092Hu01
  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q12794
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 47.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Hyaluronoglucosaminidase 1 expressed in: E.coli

Recombinant Hyaluronoglucosaminidase 1 (HYAL1)

4-RPS092Mu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q91ZJ9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 48.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Hyaluronoglucosaminidase 1 expressed in: E.coli

Recombinant Hyaluronoglucosaminidase 1 (HYAL1)

4-RPS092Ra01
  • EUR 501.41
  • EUR 237.00
  • EUR 1605.28
  • EUR 601.76
  • EUR 1103.52
  • EUR 398.00
  • EUR 3863.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q76HN1
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 50.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Hyaluronoglucosaminidase 1 expressed in: E.coli

Hyaluronoglucosaminidase 1 (HYAL1) Polyclonal Antibody (Rat)

4-PAS092Ra01
  • EUR 275.00
  • EUR 2958.00
  • EUR 727.00
  • EUR 350.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HYAL1 (Ser40~Met449)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Hyaluronoglucosaminidase 1 (HYAL1)

ELISA kit for Human HYAL1 (Hyaluronoglucosaminidase 1)

ELK7361 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Hyaluronoglucosaminidase 1 (HYAL1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of Hyaluronoglucosaminidase 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Cattle HYAL1 (Hyaluronoglucosaminidase 1)

ELK8150 1 plate of 96 wells
EUR 526
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Hyaluronoglucosaminidase 1 (HYAL1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of Hyaluronoglucosaminidase 1 from Cattle in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Cow Hyaluronoglucosaminidase 1 (HYAL1) CLIA Kit

20-abx496244
  • EUR 9242.00
  • EUR 4920.00
  • EUR 1130.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Hyaluronoglucosaminidase 1 (HYAL1) CLIA Kit

20-abx496245
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Hyaluronoglucosaminidase 1 (HYAL1) Protein

20-abx067145
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Hyaluronoglucosaminidase 1 (HYAL1) Protein

20-abx067146
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hyaluronoglucosaminidase 1 (HYAL1) Antibody (Biotin)

20-abx271882
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Hyaluronoglucosaminidase 1 (HYAL1) Antibody (FITC)

20-abx273870
  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Hyaluronoglucosaminidase 1 (HYAL1) Polyclonal Antibody (Rat), APC

4-PAS092Ra01-APC
  • EUR 388.00
  • EUR 3887.00
  • EUR 1065.00
  • EUR 501.00
  • EUR 237.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HYAL1 (Ser40~Met449)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Hyaluronoglucosaminidase 1 (HYAL1). This antibody is labeled with APC.

Hyaluronoglucosaminidase 1 (HYAL1) Polyclonal Antibody (Rat), Biotinylated

4-PAS092Ra01-Biotin
  • EUR 343.00
  • EUR 2908.00
  • EUR 839.00
  • EUR 425.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HYAL1 (Ser40~Met449)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Hyaluronoglucosaminidase 1 (HYAL1). This antibody is labeled with Biotin.

Hyaluronoglucosaminidase 1 (HYAL1) Polyclonal Antibody (Rat), Cy3

4-PAS092Ra01-Cy3
  • EUR 476.00
  • EUR 5141.00
  • EUR 1379.00
  • EUR 626.00
  • EUR 275.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HYAL1 (Ser40~Met449)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Hyaluronoglucosaminidase 1 (HYAL1). This antibody is labeled with Cy3.

Hyaluronoglucosaminidase 1 (HYAL1) Polyclonal Antibody (Rat), FITC

4-PAS092Ra01-FITC
  • EUR 330.00
  • EUR 3129.00
  • EUR 872.00
  • EUR 420.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HYAL1 (Ser40~Met449)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Hyaluronoglucosaminidase 1 (HYAL1). This antibody is labeled with FITC.

Hyaluronoglucosaminidase 1 (HYAL1) Polyclonal Antibody (Rat), HRP

4-PAS092Ra01-HRP
  • EUR 353.00
  • EUR 3385.00
  • EUR 940.00
  • EUR 451.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HYAL1 (Ser40~Met449)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Hyaluronoglucosaminidase 1 (HYAL1). This antibody is labeled with HRP.

Hyaluronoglucosaminidase 1 (HYAL1) Polyclonal Antibody (Rat), PE

4-PAS092Ra01-PE
  • EUR 330.00
  • EUR 3129.00
  • EUR 872.00
  • EUR 420.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HYAL1 (Ser40~Met449)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Hyaluronoglucosaminidase 1 (HYAL1). This antibody is labeled with PE.

Hyaluronoglucosaminidase 1 (HYAL1) Polyclonal Antibody (Human)

4-PAS092Hu01
  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HYAL1 (Phe22~Trp435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hyaluronoglucosaminidase 1 (HYAL1)

Hyaluronoglucosaminidase 1 (HYAL1) Polyclonal Antibody (Mouse)

4-PAS092Mu01
  • EUR 266.00
  • EUR 2813.00
  • EUR 694.00
  • EUR 337.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HYAL1 (Gly52~Met462)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hyaluronoglucosaminidase 1 (HYAL1)

Hyaluronoglucosaminidase 1 (HYAL1) Polyclonal Antibody (Rat), APC-Cy7

4-PAS092Ra01-APC-Cy7
  • EUR 657.00
  • EUR 7654.00
  • EUR 2011.00
  • EUR 882.00
  • EUR 355.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HYAL1 (Ser40~Met449)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Hyaluronoglucosaminidase 1 (HYAL1). This antibody is labeled with APC-Cy7.

Hyaluronoglucosaminidase 1 (HYAL1) Polyclonal Antibody (Human), APC

4-PAS092Hu01-APC
  • EUR 368.00
  • EUR 3599.00
  • EUR 993.00
  • EUR 472.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HYAL1 (Phe22~Trp435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hyaluronoglucosaminidase 1 (HYAL1). This antibody is labeled with APC.

Hyaluronoglucosaminidase 1 (HYAL1) Polyclonal Antibody (Human), Biotinylated

4-PAS092Hu01-Biotin
  • EUR 328.00
  • EUR 2697.00
  • EUR 786.00
  • EUR 404.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HYAL1 (Phe22~Trp435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hyaluronoglucosaminidase 1 (HYAL1). This antibody is labeled with Biotin.

Hyaluronoglucosaminidase 1 (HYAL1) Polyclonal Antibody (Human), Cy3

4-PAS092Hu01-Cy3
  • EUR 449.00
  • EUR 4757.00
  • EUR 1283.00
  • EUR 588.00
  • EUR 264.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HYAL1 (Phe22~Trp435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hyaluronoglucosaminidase 1 (HYAL1). This antibody is labeled with Cy3.

Hyaluronoglucosaminidase 1 (HYAL1) Polyclonal Antibody (Human), FITC

4-PAS092Hu01-FITC
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HYAL1 (Phe22~Trp435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hyaluronoglucosaminidase 1 (HYAL1). This antibody is labeled with FITC.

Hyaluronoglucosaminidase 1 (HYAL1) Polyclonal Antibody (Human), HRP

4-PAS092Hu01-HRP
  • EUR 335.00
  • EUR 3135.00
  • EUR 877.00
  • EUR 426.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HYAL1 (Phe22~Trp435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hyaluronoglucosaminidase 1 (HYAL1). This antibody is labeled with HRP.

Hyaluronoglucosaminidase 1 (HYAL1) Polyclonal Antibody (Human), PE

4-PAS092Hu01-PE
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HYAL1 (Phe22~Trp435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hyaluronoglucosaminidase 1 (HYAL1). This antibody is labeled with PE.

Hyaluronoglucosaminidase 1 (HYAL1) Polyclonal Antibody (Mouse), APC

4-PAS092Mu01-APC
  • EUR 374.00
  • EUR 3689.00
  • EUR 1016.00
  • EUR 481.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HYAL1 (Gly52~Met462)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hyaluronoglucosaminidase 1 (HYAL1). This antibody is labeled with APC.

Hyaluronoglucosaminidase 1 (HYAL1) Polyclonal Antibody (Mouse), Biotinylated

4-PAS092Mu01-Biotin
  • EUR 332.00
  • EUR 2763.00
  • EUR 803.00
  • EUR 411.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HYAL1 (Gly52~Met462)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hyaluronoglucosaminidase 1 (HYAL1). This antibody is labeled with Biotin.

Hyaluronoglucosaminidase 1 (HYAL1) Polyclonal Antibody (Mouse), Cy3

4-PAS092Mu01-Cy3
  • EUR 457.00
  • EUR 4877.00
  • EUR 1313.00
  • EUR 600.00
  • EUR 267.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HYAL1 (Gly52~Met462)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hyaluronoglucosaminidase 1 (HYAL1). This antibody is labeled with Cy3.

Hyaluronoglucosaminidase 1 (HYAL1) Polyclonal Antibody (Mouse), FITC

4-PAS092Mu01-FITC
  • EUR 319.00
  • EUR 2971.00
  • EUR 832.00
  • EUR 405.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HYAL1 (Gly52~Met462)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hyaluronoglucosaminidase 1 (HYAL1). This antibody is labeled with FITC.

Hyaluronoglucosaminidase 1 (HYAL1) Polyclonal Antibody (Mouse), HRP

4-PAS092Mu01-HRP
  • EUR 341.00
  • EUR 3213.00
  • EUR 897.00
  • EUR 433.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HYAL1 (Gly52~Met462)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hyaluronoglucosaminidase 1 (HYAL1). This antibody is labeled with HRP.

Hyaluronoglucosaminidase 1 (HYAL1) Polyclonal Antibody (Mouse), PE

4-PAS092Mu01-PE
  • EUR 319.00
  • EUR 2971.00
  • EUR 832.00
  • EUR 405.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HYAL1 (Gly52~Met462)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hyaluronoglucosaminidase 1 (HYAL1). This antibody is labeled with PE.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Hyaluronoglucosaminidase 1 (HYAL1) Polyclonal Antibody (Human), APC-Cy7

4-PAS092Hu01-APC-Cy7
  • EUR 616.00
  • EUR 7078.00
  • EUR 1867.00
  • EUR 824.00
  • EUR 338.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HYAL1 (Phe22~Trp435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hyaluronoglucosaminidase 1 (HYAL1). This antibody is labeled with APC-Cy7.

Hyaluronoglucosaminidase 1 (HYAL1) Polyclonal Antibody (Mouse), APC-Cy7

4-PAS092Mu01-APC-Cy7
  • EUR 628.00
  • EUR 7258.00
  • EUR 1912.00
  • EUR 842.00
  • EUR 344.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HYAL1 (Gly52~Met462)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hyaluronoglucosaminidase 1 (HYAL1). This antibody is labeled with APC-Cy7.

Rat Hyaluronidase 1(HYAL1) ELISA kit

E02H1379-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Hyaluronidase 1(HYAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Hyaluronidase 1(HYAL1) ELISA kit

E02H1379-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Hyaluronidase 1(HYAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Hyaluronidase 1(HYAL1) ELISA kit

E02H1379-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Hyaluronidase 1(HYAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Hyaluronidase- 1, Hyal1 ELISA KIT

ELI-04036r 96 Tests
EUR 886

Rat Hyaluronidase-1(HYAL1) ELISA kit

CSB-EL010918RA-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Hyaluronidase-1 (HYAL1) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat Hyaluronidase-1(HYAL1) ELISA kit

1-CSB-EL010918RA
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Hyaluronidase-1(HYAL1) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Hyaluronidase-1 (HYAL1) ELISA Kit

abx574035-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Anti-HYAL1 Antibody

PA2181-1 100ug/vial
EUR 334

HYAL1 ELISA Kit (Rat) (OKCD02556)

OKCD02556 96 Wells
EUR 988
Description: Description of target: May have a role in promoting tumor progression. May block the TGFB1-enhanced cell growth. Overexpression of HYAL1 suppressed the growth rate of colon carcinoma cell tumors in an experimental model.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.55 ng/mL

Bovine HYAL1/ Hyaluronidase-1 ELISA Kit

E0128Bo 1 Kit
EUR 717

Mouse Hyaluronidase 1(HYAL1) ELISA kit

E03H1379-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Hyaluronidase 1(HYAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Hyaluronidase 1(HYAL1) ELISA kit

E03H1379-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Hyaluronidase 1(HYAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Hyaluronidase 1(HYAL1) ELISA kit

E03H1379-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Hyaluronidase 1(HYAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Hyaluronidase 1(HYAL1) ELISA kit

E04H1379-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Hyaluronidase 1(HYAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Hyaluronidase 1(HYAL1) ELISA kit

E04H1379-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Hyaluronidase 1(HYAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Hyaluronidase 1(HYAL1) ELISA kit

E04H1379-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Hyaluronidase 1(HYAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Hyaluronidase 1(HYAL1) ELISA kit

E06H1379-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Hyaluronidase 1(HYAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Hyaluronidase 1(HYAL1) ELISA kit

E06H1379-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Hyaluronidase 1(HYAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Hyaluronidase 1(HYAL1) ELISA kit

E06H1379-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Hyaluronidase 1(HYAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hyaluronidase 1(HYAL1) ELISA kit

E01H1379-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Hyaluronidase 1(HYAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hyaluronidase 1(HYAL1) ELISA kit

E01H1379-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Hyaluronidase 1(HYAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hyaluronidase 1(HYAL1) ELISA kit

E01H1379-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Hyaluronidase 1(HYAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hyaluronidase-1 (HYAL1) ELISA Kit

abx250664-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Monkey Hyaluronidase 1(HYAL1) ELISA kit

E09H1379-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Hyaluronidase 1(HYAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Hyaluronidase 1(HYAL1) ELISA kit

E09H1379-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Hyaluronidase 1(HYAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Hyaluronidase 1(HYAL1) ELISA kit

E09H1379-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Hyaluronidase 1(HYAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Hyaluronidase 1(HYAL1) ELISA kit

E08H1379-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Hyaluronidase 1(HYAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Hyaluronidase 1(HYAL1) ELISA kit

E08H1379-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Hyaluronidase 1(HYAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Hyaluronidase 1(HYAL1) ELISA kit

E08H1379-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Hyaluronidase 1(HYAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human HYAL1/ Hyaluronidase-1 ELISA Kit

E2787Hu 1 Kit
EUR 571

Human HYAL1(Hyaluronidase-1) ELISA Kit

EH1390 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q12794
  • Alias: HYAL1/Hyaluronidase-1/Hyal-1/Hyaluronoglucosaminidase-1/Lung carcinoma protein 1/LuCa-1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Porcine Hyaluronidase- 1, HYAL1 ELISA KIT

ELI-04035p 96 Tests
EUR 928

Mouse Hyaluronidase- 1, Hyal1 ELISA KIT

ELI-04037m 96 Tests
EUR 865

Bovine Hyaluronidase- 1, HYAL1 ELISA KIT

ELI-04038b 96 Tests
EUR 928

Human Hyaluronidase- 1, HYAL1 ELISA KIT

ELI-04039h 96 Tests
EUR 824

Pig Hyaluronidase 1(HYAL1) ELISA kit

E07H1379-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Hyaluronidase 1(HYAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Hyaluronidase 1(HYAL1) ELISA kit

E07H1379-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Hyaluronidase 1(HYAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Hyaluronidase 1(HYAL1) ELISA kit

E07H1379-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Hyaluronidase 1(HYAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hyaluronidase-1(HYAL1) ELISA kit

CSB-EL010918HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Hyaluronidase-1 (HYAL1) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Hyaluronidase-1(HYAL1) ELISA kit

1-CSB-EL010918HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Hyaluronidase-1(HYAL1) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Hyaluronidase-1(HYAL1) ELISA kit

CSB-EL010918MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Hyaluronidase-1 (HYAL1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Hyaluronidase-1(HYAL1) ELISA kit

1-CSB-EL010918MO
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Hyaluronidase-1(HYAL1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Cow Hyaluronidase-1 (HYAL1) ELISA Kit

abx515842-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Hyaluronidase-1 (HYAL1) ELISA Kit

abx515844-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Pig Hyaluronidase-1 (HYAL1) ELISA Kit

abx515845-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human HYAL1 ELISA Kit

ELA-E1217h 96 Tests
EUR 824

HYAL1 ELISA KIT|Human

EF004548 96 Tests
EUR 689

Guinea pig Hyaluronidase 1(HYAL1) ELISA kit

E05H1379-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Hyaluronidase 1(HYAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Hyaluronidase 1(HYAL1) ELISA kit

E05H1379-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Hyaluronidase 1(HYAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Hyaluronidase 1(HYAL1) ELISA kit

E05H1379-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Hyaluronidase 1(HYAL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

HYAL1 ELISA Kit (Human) (OKAN05622)

OKAN05622 96 Wells
EUR 792
Description: Description of target: This gene encodes a lysosomal hyaluronidase. Hyaluronidases intracellularly degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. Hyaluronan is thought to be involved in cell proliferation, migration and differentiation. This enzyme is active at an acidic pH and is the major hyaluronidase in plasma. Mutations in this gene are associated with mucopolysaccharidosis type IX, or hyaluronidase deficiency. The gene is one of several related genes in a region of chromosome 3p21.3 associated with tumor suppression. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.118 ng/mL

HYAL1 ELISA Kit (Human) (OKAN05623)

OKAN05623 96 Wells
EUR 792
Description: Description of target: This gene encodes a lysosomal hyaluronidase. Hyaluronidases intracellularly degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. Hyaluronan is thought to be involved in cell proliferation, migration and differentiation. This enzyme is active at an acidic pH and is the major hyaluronidase in plasma. Mutations in this gene are associated with mucopolysaccharidosis type IX, or hyaluronidase deficiency. The gene is one of several related genes in a region of chromosome 3p21.3 associated with tumor suppression. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.119 ng/mL

HYAL1 ELISA Kit (Human) (OKBB01150)

OKBB01150 96 Wells
EUR 505
Description: Description of target: Hyaluronidase-1, also known as HYAL1 or LUCA1, is an enzyme that in humans is encoded by the HYAL1 gene. The gene is one of several related genes in a region of chromosome 3p21.3 associated with tumor suppression. This gene encodes a lysosomal hyaluronidase. Hyaluronidases intracellularly degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. Hyaluronan is thought to be involved in cell proliferation, migration and differentiation. This enzyme is active at an acidic pH and is the major hyaluronidase in plasma. Mutations in this gene are associated with mucopolysaccharidosis type IX, or hyaluronidase deficiency.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

HYAL1 ELISA Kit (Mouse) (OKCA02397)

OKCA02397 96 Wells
EUR 846
Description: Description of target: May have a role in promoting tumor progression. May block the TGFB1-enhanced cell growth.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 0.586 U/mL

HYAL1 ELISA Kit (Human) (OKCD07219)

OKCD07219 96 Wells
EUR 936
Description: Description of target: HYAL1 is a lysosomal hyaluronidase. Hyaluronidases intracellularly degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. Hyaluronan is thought to be involved in cell proliferation, migration and differentiation. This enzyme is active at an acidic pH and is the major hyaluronidase in plasma. Mutations in this gene are associated with mucopolysaccharidosis type IX, or hyaluronidase deficiency. This gene is one of several related genes in a region of chromosome 3p21.3 associated with tumor suppression. Multiple transcript variants encoding different isoforms have been found for this gene.This gene encodes a lysosomal hyaluronidase. Hyaluronidases intracellularly degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. Hyaluronan is thought to be involved in cell proliferation, migration and differentiation. This enzyme is active at an acidic pH and is the major hyaluronidase in plasma. Mutations in this gene are associated with mucopolysaccharidosis type IX, or hyaluronidase deficiency. The gene is one of several related genes in a region of chromosome 3p21.3 associated with tumor suppression. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.119ng/mL

HYAL1 ELISA Kit (Bovine) (OKCD09486)

OKCD09486 96 Wells
EUR 1262
Description: Description of target: May have a role in promoting tumor progression. May block the TGFB1-enhanced cell growth.;Species reactivity: Bovine;Application: ELISA;Assay info: ;Sensitivity: < 0.58ng/mL

HYAL1 ELISA Kit (Human) (OKCD09487)

OKCD09487 96 Wells
EUR 909
Description: Description of target: HYAL1 is a lysosomal hyaluronidase. Hyaluronidases intracellularly degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. Hyaluronan is thought to be involved in cell proliferation, migration and differentiation. This enzyme is active at an acidic pH and is the major hyaluronidase in plasma. Mutations in this gene are associated with mucopolysaccharidosis type IX, or hyaluronidase deficiency. This gene is one of several related genes in a region of chromosome 3p21.3 associated with tumor suppression. Multiple transcript variants encoding different isoforms have been found for this gene.This gene encodes a lysosomal hyaluronidase. Hyaluronidases intracellularly degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. Hyaluronan is thought to be involved in cell proliferation, migration and differentiation. This enzyme is active at an acidic pH and is the major hyaluronidase in plasma. Mutations in this gene are associated with mucopolysaccharidosis type IX, or hyaluronidase deficiency. The gene is one of several related genes in a region of chromosome 3p21.3 associated with tumor suppression. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.119ng/mL

HYAL1 ELISA Kit (Human) (OKEH00879)

OKEH00879 96 Wells
EUR 662
Description: Description of target: This gene encodes a lysosomal hyaluronidase. Hyaluronidases intracellularly degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. Hyaluronan is thought to be involved in cell proliferation, migration and differentiation. This enzyme is active at an acidic pH and is the major hyaluronidase in plasma. Mutations in this gene are associated with mucopolysaccharidosis type IX, or hyaluronidase deficiency. The gene is one of several related genes in a region of chromosome 3p21.3 associated with tumor suppression. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

HYAL1 ELISA Kit (Mouse) (OKEH05609)

OKEH05609 96 Wells
EUR 662
Description: Description of target: May have a role in promoting tumor progression. May block the TGFB1-enhanced cell growth.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.315 ng/mL

HYAL1 ELISA Kit (Bovine) (OKEH03911)

OKEH03911 96 Wells
EUR 779
Description: Description of target: May have a role in promoting tumor progression. May block the TGFB1-enhanced cell growth.;Species reactivity: Bovine;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.06 ng/mL

Human Hyaluronoglucosaminidase 2 (HYAL2)ELISA Kit

201-12-2750 96 tests
EUR 440
  • This Hyaluronoglucosaminidase 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Hyaluronoglucosaminidase 2 (HYAL2) ELISA Kit

20-abx055284
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Hyaluronoglucosaminidase 3 (HYAL3) ELISA Kit

20-abx055285
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Hyaluronoglucosaminidase 4(HYAL4)ELISA Kit

QY-E01212 96T
EUR 361

Human Hyaluronoglucosaminidase 3(HYAL3)ELISA Kit

QY-E01213 96T
EUR 361

Human Hyaluronoglucosaminidase 2(HYAL2)ELISA Kit

QY-E01214 96T
EUR 361

Human Hyaluronidase-1 (HYAL1)

1-CSB-EP623651HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 50.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Hyaluronidase-1(HYAL1) expressed in E.coli

Human Hyaluronidase-1 (HYAL1)

1-CSB-YP623651HU
  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 48.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Hyaluronidase-1(HYAL1) expressed in Yeast

Hyaluronidase-1 (HYAL1) Antibody

20-abx006372
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Hyaluronidase-1 (HYAL1) Antibody

abx037527-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Hyaluronidase-1 (HYAL1) Antibody

abx038421-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Hyaluronidase-1 (HYAL1) Antibody

abx146342-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Hyaluronidase-1 (HYAL1) Antibody

abx028388-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Hyaluronidase-1 (HYAL1) Antibody

abx028388-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Hyaluronidase-1 (HYAL1) Antibody

20-abx320222
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Hyaluronidase-1 (HYAL1) Antibody

20-abx321657
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

Rat HYAL1 shRNA Plasmid

20-abx990685
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

HYAL1 Recombinant Protein (Rat)

RP205364 100 ug Ask for price

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Human Hyaluronidase1/HYAL1 PicoKine ELISA Kit

EK1639 96 wells
EUR 425
Description: For Quantitative Detection of human HYAL1 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Hyal1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7180802 1.0 ug DNA
EUR 154

HYAL1 Antibody

39321-100ul 100ul
EUR 390

HYAL1 Antibody

1-CSB-PA623651ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against HYAL1. Recognizes HYAL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

HYAL1 Antibody

1-CSB-PA623651ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against HYAL1. Recognizes HYAL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

HYAL1 antibody

70R-9001 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal HYAL1 antibody

HYAL1 antibody

70R-9002 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal HYAL1 antibody

HYAL1 siRNA

20-abx902591
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HYAL1 siRNA

20-abx920070
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HYAL1 siRNA

20-abx920071
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-HYAL1

YF-PA12505 50 ug
EUR 363
Description: Mouse polyclonal to HYAL1

anti-HYAL1

YF-PA12506 100 ug
EUR 403
Description: Rabbit polyclonal to HYAL1

anti-HYAL1

YF-PA23937 50 ul
EUR 334
Description: Mouse polyclonal to HYAL1

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)

RAT-5 1
EUR 1138

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

Rat TIMP-1 AssayMax ELISA Kit

ERT2538-1 96 Well Plate
EUR 477

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Hyal1 ORF Vector (Rat) (pORF)

ORF068456 1.0 ug DNA
EUR 506

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

HYAL1 Chemi-Luminescent ELISA Kit (Human) (OKCD05563)

OKCD05563 96 Wells
EUR 1144
Description: Description of target: HYAL1 is a lysosomal hyaluronidase. Hyaluronidases intracellularly degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. Hyaluronan is thought to be involved in cell proliferation, migration and differentiation. This enzyme is active at an acidic pH and is the major hyaluronidase in plasma. Mutations in this gene are associated with mucopolysaccharidosis type IX, or hyaluronidase deficiency. This gene is one of several related genes in a region of chromosome 3p21.3 associated with tumor suppression. Multiple transcript variants encoding different isoforms have been found for this gene.This gene encodes a lysosomal hyaluronidase. Hyaluronidases intracellularly degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. Hyaluronan is thought to be involved in cell proliferation, migration and differentiation. This enzyme is active at an acidic pH and is the major hyaluronidase in plasma. Mutations in this gene are associated with mucopolysaccharidosis type IX, or hyaluronidase deficiency. The gene is one of several related genes in a region of chromosome 3p21.3 associated with tumor suppression. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.28ng/mL

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Hyaluronoglucosaminidase 2 (HYAL2) Antibody

20-abx214848
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Hyaluronoglucosaminidase 2 (HYAL2) Antibody

20-abx102759
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hyaluronoglucosaminidase 2 (HYAL2) Antibody

20-abx116848
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Hyaluronoglucosaminidase 2 (HYAL2) Antibody

20-abx241544
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Hyaluronoglucosaminidase 2 (HYAL2)

4-RPE237Mu01
  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O35632
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 50.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Hyaluronoglucosaminidase 2 expressed in: E.coli

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

HYAL1 Blocking Peptide

33R-9115 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HYAL1 antibody, catalog no. 70R-9002

HYAL1 Blocking Peptide

33R-9982 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HYAL1 antibody, catalog no. 70R-9001

HYAL1 Polyclonal Antibody

42654-100ul 100ul
EUR 333

HYAL1 cloning plasmid

CSB-CL623651HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1308
  • Sequence: atggcagcccacctgcttcccatctgcgccctcttcctgaccttactcgatatggcccaaggctttaggggccccttgctacccaaccggcccttcaccaccgtctggaatgcaaacacccagtggtgcctggagaggcacggtgtggacgtggatgtcagtgtcttcgatgtgg
  • Show more
Description: A cloning plasmid for the HYAL1 gene.

HYAL1 Rabbit pAb

A6623-100ul 100 ul
EUR 308

HYAL1 Rabbit pAb

A6623-200ul 200 ul
EUR 459

HYAL1 Rabbit pAb

A6623-20ul 20 ul
EUR 183

HYAL1 Rabbit pAb

A6623-50ul 50 ul
EUR 223

Anti-HYAL1 Antibody

PA2181-2 100ug/vial
EUR 294

Anti-HYAL1 antibody

STJ28706 100 µl
EUR 277
Description: This gene encodes a lysosomal hyaluronidase. Hyaluronidases intracellularly degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. Hyaluronan is thought to be involved in cell proliferation, migration and differentiation. This enzyme is active at an acidic pH and is the major hyaluronidase in plasma. Mutations in this gene are associated with mucopolysaccharidosis type IX, or hyaluronidase deficiency. The gene is one of several related genes in a region of chromosome 3p21.3 associated with tumor suppression. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-HYAL1 (2H7)

YF-MA10463 100 ug
EUR 363
Description: Mouse monoclonal to HYAL1

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Hyal1 sgRNA CRISPR Lentivector set (Rat)

K7180801 3 x 1.0 ug
EUR 339

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Mouse Hyaluronoglucosaminidase 2 (HYAL2) Protein

20-abx067147
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Hyaluronoglucosaminidase 2 (HYAL2) Antibody (Biotin)

20-abx272901
  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Hyaluronoglucosaminidase 2 (HYAL2) Antibody (FITC)

20-abx273884
  • EUR 495.00
  • EUR 258.00
  • EUR 1455.00
  • EUR 676.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Rat HYAL1(Hyaluronoglucosaminidase 1) ELISA Kit