Rat STOML2 ELISA kit

Rat STOML2 ELISA kit

STOML2 antibody
70R-20609	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal STOML2 antibody

STOML2 Antibody
39917-100ul	SAB	100ul	EUR 390

STOML2 antibody
70R-10371	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal STOML2 antibody

STOML2 siRNA
20-abx935507	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

STOML2 siRNA
20-abx935508	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

STOML2 Antibody
1-CSB-PA892131ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against STOML2. Recognizes STOML2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

STOML2 Antibody
DF12010	Affbiotech	200ul	EUR 304
Description: STOML2 antibody detects endogenous levels of STOML2.

STOML2 Antibody
1-CSB-PA022864GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against STOML2. Recognizes STOML2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

pOTB7-STOML2
PVT19033	Lifescience Market	2 ug	EUR 231

anti-STOML2
YF-PA18713	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to STOML2

anti-STOML2
YF-PA18714	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to STOML2

anti-STOML2
YF-PA18715	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to STOML2

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Stoml2 ORF Vector (Rat) (pORF)
ORF077172	ABM	1.0 ug DNA	EUR 506

Human Stomatin Like 2 (STOML2) ELISA Kit
abx383537-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

anti- STOML2 antibody
FNab08346	FN Test	100µg	EUR 548.75
Immunogen: stomatin(EPB72)-like 2 Uniprot ID: Q9UJZ1 Gene ID: 30968 Research Area: cancer
Description: Antibody raised against STOML2

anti- STOML2 antibody
FNab08347	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:2000-1:10000 IP: 1:500-1:1000 IHC: 1:50-1:500 Immunogen: stomatin(EPB72)-like 2 Uniprot ID: Q9UJZ1 Gene ID: 30968 Research Area: cancer
Description: Antibody raised against STOML2

STOML2 Rabbit pAb
A10398-100ul	Abclonal	100 ul	EUR 308

STOML2 Rabbit pAb
A10398-200ul	Abclonal	200 ul	EUR 459

STOML2 Rabbit pAb
A10398-20ul	Abclonal	20 ul	EUR 183

STOML2 Rabbit pAb
A10398-50ul	Abclonal	50 ul	EUR 223

STOML2 Rabbit pAb
A4688-100ul	Abclonal	100 ul	EUR 308

STOML2 Rabbit pAb
A4688-200ul	Abclonal	200 ul	EUR 459

STOML2 Rabbit pAb
A4688-20ul	Abclonal	20 ul	Ask for price

STOML2 Rabbit pAb
A4688-50ul	Abclonal	50 ul	Ask for price

STOML2 Blocking Peptide
33R-9858	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of STOML2 antibody, catalog no. 70R-10371

STOML2 Polyclonal Antibody
27419-100ul	SAB	100ul	EUR 252

STOML2 Polyclonal Antibody
27419-50ul	SAB	50ul	EUR 187

STOML2 Blocking Peptide
DF12010-BP	Affbiotech	1mg	EUR 195

STOML2 cloning plasmid
CSB-CL892131HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1071 Sequence: atgctggcgcgcgcggcgcggggcactggggcccttttgctgaggggctctctactggcttctggccgcgctccgcgccgcgcctcctctggattgccccgaaacaccgtggtactgttcgtgccgcagcaggaggcctgggtggtggagcgaatgggccgattccaccggatcc Show more
Description: A cloning plasmid for the STOML2 gene.

STOML2 cloning plasmid
CSB-CL892131HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1071 Sequence: atgctggcgcgcgcggcgcggggcactggggcccttttgctgaggggctctctactggcttctggccgcgctccgcgccgcgcctcctctggattgccccgaaacaccgtggtactgttcgtgccgcagcaggaggcctgggtggtggagcgaatgggccgattccaccggatcc Show more
Description: A cloning plasmid for the STOML2 gene.

Anti-STOML2 antibody
PAab08346	Lifescience Market	100 ug	EUR 386

pOTB7-stoml2 Plasmid
PVTB00105	Lifescience Market	2 ug	EUR 356

pOTB7-STOML2 Plasmid
PVTB00250S	Lifescience Market	2 ug	EUR 356

pENTR223-STOML2 vector
PVT12019	Lifescience Market	2 ug	EUR 308

Anti-STOML2 antibody
STJ25737	St John's Laboratory	100 µl	EUR 277

Anti-STOML2 antibody
STJ112434	St John's Laboratory	100 µl	EUR 277

Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)
RAT-5	Alpha Diagnostics	1	EUR 1138

Stoml2 sgRNA CRISPR Lentivector set (Rat)
K7189501	ABM	3 x 1.0 ug	EUR 339

Mouse Stomatin- like protein 2, Stoml2 ELISA KIT
ELI-53363m	Lifescience Market	96 Tests	EUR 865

Bovine Stomatin- like protein 2, STOML2 ELISA KIT
ELI-46244b	Lifescience Market	96 Tests	EUR 928

Human Stomatin- like protein 2, STOML2 ELISA KIT
ELI-39539h	Lifescience Market	96 Tests	EUR 824

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Polyclonal STOML2 Antibody (Center)
APR04539G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STOML2 (Center). This antibody is tested and proven to work in the following applications:

STOML2 Polyclonal Conjugated Antibody
C27419	SAB	100ul	EUR 397

Mouse STOML2 shRNA Plasmid
20-abx975687	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human STOML2 shRNA Plasmid
20-abx959362	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

STOML2 Recombinant Protein (Human)
RP030469	ABM	100 ug	Ask for price

STOML2 Recombinant Protein (Human)
RP030472	ABM	100 ug	Ask for price

STOML2 Recombinant Protein (Mouse)
RP176132	ABM	100 ug	Ask for price

pCMV-SPORT6-Stoml2-m
PVT18858	Lifescience Market	2 ug	EUR 231

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Stoml2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7189502	ABM	1.0 ug DNA	EUR 154

Stoml2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7189503	ABM	1.0 ug DNA	EUR 154

Stoml2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7189504	ABM	1.0 ug DNA	EUR 154

STOML2 Protein Vector (Rat) (pPB-C-His)
PV308686	ABM	500 ng	EUR 603

STOML2 Protein Vector (Rat) (pPB-N-His)
PV308687	ABM	500 ng	EUR 603

STOML2 Protein Vector (Rat) (pPM-C-HA)
PV308688	ABM	500 ng	EUR 603

STOML2 Protein Vector (Rat) (pPM-C-His)
PV308689	ABM	500 ng	EUR 603

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

Stomatin Like 2 (STOML2) Antibody
20-abx126669	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Stomatin Like 2 (STOML2) Antibody
abx036120-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Stomatin Like 2 (STOML2) Antibody
20-abx003539	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Stomatin Like 2 (STOML2) Antibody
abx031486-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Stomatin Like 2 (STOML2) Antibody
abx031486-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Stomatin Like 2 (STOML2) Antibody
20-abx321350	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Stomatin Like 2 (STOML2) Antibody
abx238346-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Stomatin Like 2 (STOML2) Antibody
abx238347-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Stoml2 ORF Vector (Mouse) (pORF)
ORF058712	ABM	1.0 ug DNA	EUR 506

STOML2 ORF Vector (Human) (pORF)
ORF010157	ABM	1.0 ug DNA	EUR 95

STOML2 ORF Vector (Human) (pORF)
ORF010158	ABM	1.0 ug DNA	EUR 95

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

STOML2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV690319	ABM	1.0 ug DNA	EUR 682

STOML2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV690323	ABM	1.0 ug DNA	EUR 682

STOML2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV690324	ABM	1.0 ug DNA	EUR 682

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

STOML2 sgRNA CRISPR Lentivector set (Human)
K2305701	ABM	3 x 1.0 ug	EUR 339

Stoml2 sgRNA CRISPR Lentivector set (Mouse)
K4605401	ABM	3 x 1.0 ug	EUR 339

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

vWF Acty. Kit
ABP-ACT-KIT	Abpcorp	12 x 8 microwells	EUR 428

vWF Ant. Kit
ABP-TOT-KIT	Abpcorp	12 x 8 microwells	EUR 394

Stoml2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7189505	ABM	3 x 1.0 ug	EUR 376

STOML2 sgRNA CRISPR Lentivector (Human) (Target 1)
K2305702	ABM	1.0 ug DNA	EUR 154

STOML2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2305703	ABM	1.0 ug DNA	EUR 154

STOML2 sgRNA CRISPR Lentivector (Human) (Target 3)
K2305704	ABM	1.0 ug DNA	EUR 154

Stoml2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4605402	ABM	1.0 ug DNA	EUR 154

Stoml2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4605403	ABM	1.0 ug DNA	EUR 154

Stoml2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4605404	ABM	1.0 ug DNA	EUR 154

STOML2 Protein Vector (Human) (pPB-C-His)
PV040625	ABM	500 ng	EUR 329

STOML2 Protein Vector (Human) (pPB-N-His)
PV040626	ABM	500 ng	EUR 329

STOML2 Protein Vector (Human) (pPM-C-HA)
PV040627	ABM	500 ng	EUR 329

STOML2 Protein Vector (Human) (pPM-C-His)
PV040628	ABM	500 ng	EUR 329

STOML2 Protein Vector (Human) (pPB-C-His)
PV040629	ABM	500 ng	EUR 329

STOML2 Protein Vector (Human) (pPB-N-His)
PV040630	ABM	500 ng	EUR 329

STOML2 Protein Vector (Human) (pPM-C-HA)
PV040631	ABM	500 ng	EUR 329

STOML2 Protein Vector (Human) (pPM-C-His)
PV040632	ABM	500 ng	EUR 329

STOML2 Protein Vector (Mouse) (pPB-C-His)
PV234846	ABM	500 ng	EUR 603

STOML2 Protein Vector (Mouse) (pPB-N-His)
PV234847	ABM	500 ng	EUR 603

STOML2 Protein Vector (Mouse) (pPM-C-HA)
PV234848	ABM	500 ng	EUR 603

STOML2 Protein Vector (Mouse) (pPM-C-His)
PV234849	ABM	500 ng	EUR 603

Stoml2 3'UTR GFP Stable Cell Line
TU169867	ABM	1.0 ml	Ask for price

Stoml2 3'UTR Luciferase Stable Cell Line
TU119867	ABM	1.0 ml	Ask for price

STOML2 3'UTR GFP Stable Cell Line
TU074839	ABM	1.0 ml	EUR 1394

STOML2 3'UTR Luciferase Stable Cell Line
TU024839	ABM	1.0 ml	EUR 1394

Stoml2 3'UTR Luciferase Stable Cell Line
TU221333	ABM	1.0 ml	Ask for price

Stoml2 3'UTR GFP Stable Cell Line
TU271333	ABM	1.0 ml	Ask for price

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)
CAS620A-KIT	SBI	1 kit	EUR 2152
Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PrecisionX Multiplex gRNA Cloning Kit
CAS9-GRNA-KIT	SBI	10 rxn	EUR 445
Category: Cas9

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

STOML2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV690320	ABM	1.0 ug DNA	EUR 682

STOML2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV690321	ABM	1.0 ug DNA	EUR 740

STOML2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV690322	ABM	1.0 ug DNA	EUR 740

Stoml2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K7189506	ABM	1.0 ug DNA	EUR 167

Stoml2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K7189507	ABM	1.0 ug DNA	EUR 167

Stoml2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K7189508	ABM	1.0 ug DNA	EUR 167

STOML2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV715539	ABM	1.0 ug DNA	EUR 316

STOML2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV715543	ABM	1.0 ug DNA	EUR 316

STOML2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV715544	ABM	1.0 ug DNA	EUR 316

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)
CASCL9-100A-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

STOML2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2305705	ABM	3 x 1.0 ug	EUR 376

Stoml2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4605405	ABM	3 x 1.0 ug	EUR 376

STOML2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2305706	ABM	1.0 ug DNA	EUR 167

STOML2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2305707	ABM	1.0 ug DNA	EUR 167

STOML2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2305708	ABM	1.0 ug DNA	EUR 167

Stoml2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4605406	ABM	1.0 ug DNA	EUR 167

Stoml2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4605407	ABM	1.0 ug DNA	EUR 167

Stoml2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4605408	ABM	1.0 ug DNA	EUR 167

STOML2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV715540	ABM	1.0 ug DNA	EUR 316

STOML2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV715541	ABM	1.0 ug DNA	EUR 374

STOML2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV715542	ABM	1.0 ug DNA	EUR 374

AXYGEN® AXYPET® PRO STARTER KIT: 4 PIPETTORS, PLEXI STAND, SAMPLE TIPS
AP-STR-KIT-P	CORNING	1/pk	EUR 721
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2	CORNING	1/pk	EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

/ Rat ELISA Kit
ELA-E0703r	Lifescience Market	96 Tests	EUR 886

/ Rat ELISA Kit
ELA-E1084r	Lifescience Market	96 Tests	EUR 886

TRF ELISA Kit| Rat Transferrin ELISA Kit
EF018096	Lifescience Market	96 Tests	EUR 689

TRX ELISA Kit| Rat Thioredoxin ELISA Kit
EF018097	Lifescience Market	96 Tests	EUR 689

TRY ELISA Kit| Rat Trypsin ELISA Kit
EF018099	Lifescience Market	96 Tests	EUR 689

TYR ELISA Kit| Rat Tyrosinase ELISA Kit
EF018105	Lifescience Market	96 Tests	EUR 689

VF ELISA Kit| Rat Visfatin ELISA Kit
EF018113	Lifescience Market	96 Tests	EUR 689

AD ELISA Kit| Rat Adropin ELISA Kit
EF018137	Lifescience Market	96 Tests	EUR 689

T ELISA Kit| Rat Testosterone ELISA Kit
EF018139	Lifescience Market	96 Tests	EUR 689

Ach ELISA Kit| Rat Acetylcholine ELISA Kit
EF018143	Lifescience Market	96 Tests	EUR 689

CFP ELISA Kit| Rat Properdin ELISA Kit
EF018144	Lifescience Market	96 Tests	EUR 689

BrdU ELISA Kit| Rat Bromodeoxyuridine ELISA Kit
EF018146	Lifescience Market	96 Tests	EUR 689

Estrone ELISA Kit| Rat Estrone ELISA Kit
EF018156	Lifescience Market	96 Tests	EUR 689

E2 ELISA Kit| Rat Estradiol ELISA Kit
EF018157	Lifescience Market	96 Tests	EUR 689

HCY ELISA Kit| Rat Homocysteine ELISA Kit
EF018158	Lifescience Market	96 Tests	EUR 689

GAGs ELISA Kit| Rat Glycosaminoglycan ELISA Kit
EF018159	Lifescience Market	96 Tests	EUR 689

DAG ELISA Kit| Rat Diacylglycerol ELISA Kit
EF018164	Lifescience Market	96 Tests	EUR 689

MTL5 ELISA Kit| Rat Tesmin ELISA Kit
EF018168	Lifescience Market	96 Tests	EUR 689

FATP4 ELISA Kit| Rat FATP4 ELISA Kit
EF018183	Lifescience Market	96 Tests	EUR 689

Hyp ELISA Kit| Rat Hydroxyproline ELISA Kit
EF018211	Lifescience Market	96 Tests	EUR 689

Adipolin ELISA Kit| Rat FAM132A ELISA Kit
EF018220	Lifescience Market	96 Tests	EUR 689

Calprotectin ELISA Kit| Rat Calprotectin ELISA Kit
EF018230	Lifescience Market	96 Tests	EUR 689

Ahi1 ELISA Kit| Rat Jouberin ELISA Kit
EF018267	Lifescience Market	96 Tests	EUR 689

Ahcy ELISA Kit| Rat Adenosylhomocysteinase ELISA Kit
EF018288	Lifescience Market	96 Tests	EUR 689

Afm ELISA Kit| Rat Afamin ELISA Kit
EF018303	Lifescience Market	96 Tests	EUR 689

Atrn ELISA Kit| Rat Attractin ELISA Kit
EF018356	Lifescience Market	96 Tests	EUR 689

Bsnd ELISA Kit| Rat Barttin ELISA Kit
EF018361	Lifescience Market	96 Tests	EUR 689

Bfsp1 ELISA Kit| Rat Filensin ELISA Kit
EF018367	Lifescience Market	96 Tests	EUR 689

Bscl2 ELISA Kit| Rat Seipin ELISA Kit
EF018368	Lifescience Market	96 Tests	EUR 689

Bgn ELISA Kit| Rat Biglycan ELISA Kit
EF018374	Lifescience Market	96 Tests	EUR 689

Btd ELISA Kit| Rat Biotinidase ELISA Kit
EF018377	Lifescience Market	96 Tests	EUR 689

Ccin ELISA Kit| Rat Calicin ELISA Kit
EF018416	Lifescience Market	96 Tests	EUR 689

Cdca8 ELISA Kit| Rat Borealin ELISA Kit
EF018458	Lifescience Market	96 Tests	EUR 689

Cntln ELISA Kit| Rat Centlein ELISA Kit
EF018460	Lifescience Market	96 Tests	EUR 689

Chad ELISA Kit| Rat Chondroadherin ELISA Kit
EF018480	Lifescience Market	96 Tests	EUR 689

Cygb ELISA Kit| Rat Cytoglobin ELISA Kit
EF018543	Lifescience Market	96 Tests	EUR 689

Dfnb31 ELISA Kit| Rat Whirlin ELISA Kit
EF018555	Lifescience Market	96 Tests	EUR 689

Dstn ELISA Kit| Rat Destrin ELISA Kit
EF018573	Lifescience Market	96 Tests	EUR 689

Dpys ELISA Kit| Rat Dihydropyrimidinase ELISA Kit
EF018581	Lifescience Market	96 Tests	EUR 689

Dixdc1 ELISA Kit| Rat Dixin ELISA Kit
EF018596	Lifescience Market	96 Tests	EUR 689

Dbn1 ELISA Kit| Rat Drebrin ELISA Kit
EF018604	Lifescience Market	96 Tests	EUR 689

Dym ELISA Kit| Rat Dymeclin ELISA Kit
EF018613	Lifescience Market	96 Tests	EUR 689

Dtnbp1 ELISA Kit| Rat Dysbindin ELISA Kit
EF018621	Lifescience Market	96 Tests	EUR 689

Emb ELISA Kit| Rat Embigin ELISA Kit
EF018628	Lifescience Market	96 Tests	EUR 689

Emd ELISA Kit| Rat Emerin ELISA Kit
EF018629	Lifescience Market	96 Tests	EUR 689

Emcn ELISA Kit| Rat Endomucin ELISA Kit
EF018631	Lifescience Market	96 Tests	EUR 689

Ermn ELISA Kit| Rat Ermin ELISA Kit
EF018647	Lifescience Market	96 Tests	EUR 689

Rat STOML2 ELISA kit