STOML2 antibody

70R-20609 50 ul
EUR 435
Description: Rabbit polyclonal STOML2 antibody

STOML2 Antibody

39917-100ul 100ul
EUR 390

STOML2 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against STOML2. Recognizes STOML2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

STOML2 Antibody

DF12010 200ul
EUR 304
Description: STOML2 antibody detects endogenous levels of STOML2.

STOML2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against STOML2. Recognizes STOML2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


PVT19033 2 ug
EUR 231


YF-PA18713 50 ug
EUR 363
Description: Mouse polyclonal to STOML2


YF-PA18714 100 ul
EUR 403
Description: Rabbit polyclonal to STOML2


YF-PA18715 100 ug
EUR 403
Description: Rabbit polyclonal to STOML2

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Stoml2 ORF Vector (Rat) (pORF)

ORF077172 1.0 ug DNA
EUR 506

Human Stomatin Like 2 (STOML2) ELISA Kit

abx383537-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

STOML2 Polyclonal Antibody

27419-100ul 100ul
EUR 252

STOML2 Polyclonal Antibody

27419-50ul 50ul
EUR 187

STOML2 Rabbit pAb

A10398-100ul 100 ul
EUR 308

STOML2 Rabbit pAb

A10398-200ul 200 ul
EUR 459

STOML2 Rabbit pAb

A10398-20ul 20 ul
EUR 183

STOML2 Rabbit pAb

A10398-50ul 50 ul
EUR 223

STOML2 Blocking Peptide

33R-9858 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of STOML2 antibody, catalog no. 70R-10371

STOML2 cloning plasmid

CSB-CL892131HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1071
  • Sequence: atgctggcgcgcgcggcgcggggcactggggcccttttgctgaggggctctctactggcttctggccgcgctccgcgccgcgcctcctctggattgccccgaaacaccgtggtactgttcgtgccgcagcaggaggcctgggtggtggagcgaatgggccgattccaccggatcc
  • Show more
Description: A cloning plasmid for the STOML2 gene.

STOML2 cloning plasmid

CSB-CL892131HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1071
  • Sequence: atgctggcgcgcgcggcgcggggcactggggcccttttgctgaggggctctctactggcttctggccgcgctccgcgccgcgcctcctctggattgccccgaaacaccgtggtactgttcgtgccgcagcaggaggcctgggtggtggagcgaatgggccgattccaccggatcc
  • Show more
Description: A cloning plasmid for the STOML2 gene.

STOML2 Blocking Peptide

DF12010-BP 1mg
EUR 195

STOML2 Rabbit pAb

A4688-100ul 100 ul
EUR 308

STOML2 Rabbit pAb

A4688-200ul 200 ul
EUR 459

STOML2 Rabbit pAb

A4688-20ul 20 ul Ask for price

STOML2 Rabbit pAb

A4688-50ul 50 ul Ask for price

anti- STOML2 antibody

FNab08346 100µg
EUR 548.75
  • Immunogen: stomatin(EPB72)-like 2
  • Uniprot ID: Q9UJZ1
  • Gene ID: 30968
  • Research Area: cancer
Description: Antibody raised against STOML2

anti- STOML2 antibody

FNab08347 100µg
EUR 548.75
  • Recommended dilution: WB: 1:2000-1:10000
  • IP: 1:500-1:1000
  • IHC: 1:50-1:500
  • Immunogen: stomatin(EPB72)-like 2
  • Uniprot ID: Q9UJZ1
  • Gene ID: 30968
  • Research Area: cancer
Description: Antibody raised against STOML2

Anti-STOML2 antibody

PAab08346 100 ug
EUR 386

pENTR223-STOML2 vector

PVT12019 2 ug
EUR 308

pOTB7-stoml2 Plasmid

PVTB00105 2 ug
EUR 356

pOTB7-STOML2 Plasmid

PVTB00250S 2 ug
EUR 356

Anti-STOML2 antibody

STJ25737 100 µl
EUR 277

Anti-STOML2 antibody

STJ112434 100 µl
EUR 277

Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)

RAT-5 1
EUR 1138

Stoml2 sgRNA CRISPR Lentivector set (Rat)

K7189501 3 x 1.0 ug
EUR 339

Mouse Stomatin- like protein 2, Stoml2 ELISA KIT

ELI-53363m 96 Tests
EUR 865

Bovine Stomatin- like protein 2, STOML2 ELISA KIT

ELI-46244b 96 Tests
EUR 928

Human Stomatin- like protein 2, STOML2 ELISA KIT

ELI-39539h 96 Tests
EUR 824

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Polyclonal STOML2 Antibody (Center)

APR04539G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STOML2 (Center). This antibody is tested and proven to work in the following applications:

Mouse STOML2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

STOML2 Polyclonal Conjugated Antibody

C27419 100ul
EUR 397

Human STOML2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


PVT18858 2 ug
EUR 231

STOML2 Recombinant Protein (Human)

RP030469 100 ug Ask for price

STOML2 Recombinant Protein (Human)

RP030472 100 ug Ask for price

STOML2 Recombinant Protein (Mouse)

RP176132 100 ug Ask for price

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Stoml2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7189502 1.0 ug DNA
EUR 154

Stoml2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7189503 1.0 ug DNA
EUR 154

Stoml2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7189504 1.0 ug DNA
EUR 154

STOML2 Protein Vector (Rat) (pPB-C-His)

PV308686 500 ng
EUR 603

STOML2 Protein Vector (Rat) (pPB-N-His)

PV308687 500 ng
EUR 603

STOML2 Protein Vector (Rat) (pPM-C-HA)

PV308688 500 ng
EUR 603

STOML2 Protein Vector (Rat) (pPM-C-His)

PV308689 500 ng
EUR 603

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Stomatin Like 2 (STOML2) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Stomatin Like 2 (STOML2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Stomatin Like 2 (STOML2) Antibody

abx036120-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Stomatin Like 2 (STOML2) Antibody

abx031486-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Stomatin Like 2 (STOML2) Antibody

abx031486-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Stomatin Like 2 (STOML2) Antibody

abx238346-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Stomatin Like 2 (STOML2) Antibody

abx238347-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Stomatin Like 2 (STOML2) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

STOML2 ORF Vector (Human) (pORF)

ORF010157 1.0 ug DNA
EUR 95

STOML2 ORF Vector (Human) (pORF)

ORF010158 1.0 ug DNA
EUR 95

Stoml2 ORF Vector (Mouse) (pORF)

ORF058712 1.0 ug DNA
EUR 506

STOML2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV690319 1.0 ug DNA
EUR 682

STOML2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV690323 1.0 ug DNA
EUR 682

STOML2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV690324 1.0 ug DNA
EUR 682

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

EUR 153
  • Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Stoml2 sgRNA CRISPR Lentivector set (Mouse)

K4605401 3 x 1.0 ug
EUR 339

STOML2 sgRNA CRISPR Lentivector set (Human)

K2305701 3 x 1.0 ug
EUR 339